Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:Kirrel'

246818

Institutional Source

Beutler Lab

Gene Symbol

Kirrel

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

Kirrel1, 6720469N11Rik, Neph1

MMRRC Submission

040336-MU

Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87078593-87174747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87088485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 381 (V381I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably damaging
Transcript: ENSMUST00000041732
AA Change: V381I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: V381I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107618
AA Change: V381I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: V381I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159976
AA Change: V381I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: V381I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0708

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Kirrel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel	APN	3	87089875	missense	probably benign	0.22
IGL01865:Kirrel	APN	3	87086424	missense	probably damaging	1.00
IGL01875:Kirrel	APN	3	87095730	missense	probably damaging	1.00
IGL02337:Kirrel	APN	3	87089212	missense	possibly damaging	0.64
IGL02724:Kirrel	APN	3	87090473	nonsense	probably null
IGL02825:Kirrel	APN	3	87089288	splice site	probably benign
IGL02826:Kirrel	APN	3	87088485	missense	probably damaging	1.00
IGL03102:Kirrel	APN	3	87083500	missense	probably damaging	0.98
D4043:Kirrel	UTSW	3	87083203	missense	probably benign	0.02
R0360:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0364:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0421:Kirrel	UTSW	3	87083607	missense	probably damaging	0.99
R0503:Kirrel	UTSW	3	87097802	missense	probably benign	0.20
R1112:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1116:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1144:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1190:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1226:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1501:Kirrel	UTSW	3	87090472	missense	probably benign	0.02
R1538:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1546:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1628:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1630:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1631:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1664:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1671:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1695:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1769:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1807:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1808:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1840:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1995:Kirrel	UTSW	3	87095786	missense	possibly damaging	0.88
R2014:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2086:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2108:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2407:Kirrel	UTSW	3	87084843	missense	probably benign	0.03
R2904:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2905:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2958:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2959:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2960:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2961:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3026:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3028:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3034:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R3149:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3195:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3196:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3499:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3699:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3720:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3721:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3788:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3793:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3877:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3901:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3910:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3911:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3912:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3913:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3930:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3931:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4022:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4067:Kirrel	UTSW	3	87088467	nonsense	probably null
R4077:Kirrel	UTSW	3	87085080	critical splice donor site	probably null
R4198:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4328:Kirrel	UTSW	3	87084774	intron	probably benign
R4355:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4363:Kirrel	UTSW	3	87090485	nonsense	probably null
R4378:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4386:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4460:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4468:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4469:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4650:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4652:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4734:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4748:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4749:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R5304:Kirrel	UTSW	3	87089595	missense	probably benign	0.02
R5534:Kirrel	UTSW	3	87090518	missense	probably damaging	1.00
R5604:Kirrel	UTSW	3	87089155	missense	possibly damaging	0.69
R7199:Kirrel	UTSW	3	87083388	missense	probably benign	0.02
R7221:Kirrel	UTSW	3	87086397	nonsense	probably null
R7284:Kirrel	UTSW	3	87083387	missense	probably benign	0.02
R7332:Kirrel	UTSW	3	87088398	missense	probably benign	0.14
R7369:Kirrel	UTSW	3	87141084	missense	probably benign	0.20
R7371:Kirrel	UTSW	3	87088422	missense	probably benign	0.44
R7508:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R7566:Kirrel	UTSW	3	87088484	missense	probably damaging	1.00
R7567:Kirrel	UTSW	3	87095681	missense	probably damaging	0.99
R7621:Kirrel	UTSW	3	87088221	missense	possibly damaging	0.70
R8030:Kirrel	UTSW	3	87097775	missense	probably damaging	1.00
R8141:Kirrel	UTSW	3	87086428	nonsense	probably null
R8261:Kirrel	UTSW	3	87088002	intron	probably benign
R8477:Kirrel	UTSW	3	87084831	missense	possibly damaging	0.71
R8512:Kirrel	UTSW	3	87088227	missense	probably benign	0.00
R8954:Kirrel	UTSW	3	87089866	missense	probably benign	0.25
R8987:Kirrel	UTSW	3	87085093	missense	probably damaging	1.00
R9058:Kirrel	UTSW	3	87085135	missense	probably benign	0.18
R9146:Kirrel	UTSW	3	87095708	missense	probably damaging	1.00
R9311:Kirrel	UTSW	3	87097816	missense	probably benign	0.29
Z1177:Kirrel	UTSW	3	87083875	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTCAGGCCAACAGCTTC -3'
(R):5'- TATCGTAGCAGGCACCTGTG -3'

Sequencing Primer
(F):5'- AACAGCTTCAGTGCTCTTTGGAC -3'
(R):5'- GCTTATTGCCAGCCTGCTTAGAG -3'

Posted On

2014-10-30