Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:Col9a2'

246820

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

040336-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 121054258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 599 (R599G)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058754

SMART Domains

Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M48_N	41	225	2.5e-70	PFAM
Pfam:Peptidase_M48	228	473	5.5e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Meta Mutation Damage Score

0.3183

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTGGTACATAGTAAATGCCAG -3'
(R):5'- AATGCCAGGCTTCCACAAAG -3'

Sequencing Primer
(F):5'- GCCAGTTATGTATTGGACAATTTCC -3'
(R):5'- GAAAGCCCAGATGCCCATGG -3'

Posted On

2014-10-30