Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:D630045J12Rik'

246822

Institutional Source

Beutler Lab

Gene Symbol

D630045J12Rik

Ensembl Gene

ENSMUSG00000063455

Gene Name

RIKEN cDNA D630045J12 gene

Synonyms

MMRRC Submission

040336-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38123174-38254009 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38158091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1385 (P1385S)

Ref Sequence

ENSEMBL: ENSMUSP00000130121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]

AlphaFold

Q68FD9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117556
AA Change: P1244S

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: P1244S

Domain	Start	End	E-Value	Type
low complexity region	190	203	N/A	INTRINSIC
low complexity region	290	301	N/A	INTRINSIC
low complexity region	414	431	N/A	INTRINSIC
low complexity region	528	573	N/A	INTRINSIC
low complexity region	581	598	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
Pfam:DUF3827	746	1412	N/A	PFAM
low complexity region	1480	1500	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152464

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169256
AA Change: P1385S

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: P1385S

Domain	Start	End	E-Value	Type
signal peptide	1	45	N/A	INTRINSIC
low complexity region	469	482	N/A	INTRINSIC
low complexity region	569	580	N/A	INTRINSIC
low complexity region	693	710	N/A	INTRINSIC
low complexity region	807	852	N/A	INTRINSIC
low complexity region	860	877	N/A	INTRINSIC
transmembrane domain	987	1009	N/A	INTRINSIC
Pfam:DUF3827	1026	1691	7.1e-301	PFAM
low complexity region	1759	1779	N/A	INTRINSIC

Meta Mutation Damage Score

0.5590

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in D630045J12Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00578:D630045J12Rik	APN	6	38194930	missense	probably benign	0.03
IGL01089:D630045J12Rik	APN	6	38136963	missense	probably benign
IGL01745:D630045J12Rik	APN	6	38191720	missense	probably damaging	0.99
IGL02069:D630045J12Rik	APN	6	38184072	missense	probably damaging	0.98
IGL02238:D630045J12Rik	APN	6	38196394	missense	probably benign
IGL02496:D630045J12Rik	APN	6	38149705	missense	probably damaging	1.00
IGL02675:D630045J12Rik	APN	6	38195485	missense	possibly damaging	0.93
IGL03030:D630045J12Rik	APN	6	38149713	missense	probably damaging	1.00
IGL03203:D630045J12Rik	APN	6	38168221	missense	probably damaging	0.98
IGL03205:D630045J12Rik	APN	6	38147259	missense	probably damaging	1.00
PIT4472001:D630045J12Rik	UTSW	6	38178839	missense	probably damaging	1.00
PIT4687001:D630045J12Rik	UTSW	6	38195101	missense	probably benign
R0021:D630045J12Rik	UTSW	6	38183967	nonsense	probably null
R0021:D630045J12Rik	UTSW	6	38183967	nonsense	probably null
R0128:D630045J12Rik	UTSW	6	38149771	splice site	probably benign
R0130:D630045J12Rik	UTSW	6	38149771	splice site	probably benign
R0206:D630045J12Rik	UTSW	6	38139450	missense	probably damaging	0.99
R0208:D630045J12Rik	UTSW	6	38139450	missense	probably damaging	0.99
R0347:D630045J12Rik	UTSW	6	38181392	missense	probably damaging	0.97
R0396:D630045J12Rik	UTSW	6	38196736	missense	possibly damaging	0.85
R0538:D630045J12Rik	UTSW	6	38191693	missense	probably damaging	1.00
R0636:D630045J12Rik	UTSW	6	38196778	missense	probably benign
R0842:D630045J12Rik	UTSW	6	38148465	missense	probably damaging	1.00
R1120:D630045J12Rik	UTSW	6	38194770	missense	probably damaging	0.96
R1323:D630045J12Rik	UTSW	6	38148508	missense	probably damaging	1.00
R1323:D630045J12Rik	UTSW	6	38148508	missense	probably damaging	1.00
R1412:D630045J12Rik	UTSW	6	38195760	missense	probably benign	0.03
R1546:D630045J12Rik	UTSW	6	38190655	missense	probably damaging	1.00
R1649:D630045J12Rik	UTSW	6	38181431	missense	probably damaging	0.98
R1704:D630045J12Rik	UTSW	6	38139427	missense	probably benign	0.14
R1969:D630045J12Rik	UTSW	6	38168143	missense	probably damaging	1.00
R1971:D630045J12Rik	UTSW	6	38168143	missense	probably damaging	1.00
R2182:D630045J12Rik	UTSW	6	38174147	critical splice donor site	probably null
R2926:D630045J12Rik	UTSW	6	38168171	missense	probably damaging	1.00
R3768:D630045J12Rik	UTSW	6	38142909	missense	probably damaging	1.00
R3886:D630045J12Rik	UTSW	6	38142698	missense	possibly damaging	0.90
R4439:D630045J12Rik	UTSW	6	38194761	missense	probably benign	0.07
R4688:D630045J12Rik	UTSW	6	38196657	missense	possibly damaging	0.85
R4739:D630045J12Rik	UTSW	6	38196036	missense	possibly damaging	0.76
R4748:D630045J12Rik	UTSW	6	38196841	missense	possibly damaging	0.91
R4792:D630045J12Rik	UTSW	6	38148340	missense	probably damaging	1.00
R4794:D630045J12Rik	UTSW	6	38194485	missense	possibly damaging	0.90
R4947:D630045J12Rik	UTSW	6	38148543	missense	probably damaging	1.00
R4959:D630045J12Rik	UTSW	6	38148367	missense	possibly damaging	0.81
R4973:D630045J12Rik	UTSW	6	38148367	missense	possibly damaging	0.81
R5261:D630045J12Rik	UTSW	6	38194620	missense	probably benign
R5344:D630045J12Rik	UTSW	6	38158228	missense	probably damaging	1.00
R5488:D630045J12Rik	UTSW	6	38196847	missense	possibly damaging	0.85
R5489:D630045J12Rik	UTSW	6	38196847	missense	possibly damaging	0.85
R5605:D630045J12Rik	UTSW	6	38191764	missense	probably damaging	1.00
R5828:D630045J12Rik	UTSW	6	38196367	missense	possibly damaging	0.47
R5831:D630045J12Rik	UTSW	6	38142657	missense	possibly damaging	0.80
R5939:D630045J12Rik	UTSW	6	38194969	missense	possibly damaging	0.70
R6021:D630045J12Rik	UTSW	6	38190617	missense	probably benign	0.05
R6060:D630045J12Rik	UTSW	6	38130864	missense	probably damaging	1.00
R6081:D630045J12Rik	UTSW	6	38142698	missense	probably damaging	0.99
R6498:D630045J12Rik	UTSW	6	38147197	nonsense	probably null
R6930:D630045J12Rik	UTSW	6	38158216	missense	probably damaging	1.00
R7019:D630045J12Rik	UTSW	6	38194635	missense	probably benign	0.12
R7156:D630045J12Rik	UTSW	6	38195029	missense	possibly damaging	0.91
R7248:D630045J12Rik	UTSW	6	38168263	missense	probably damaging	1.00
R7249:D630045J12Rik	UTSW	6	38136950	missense	possibly damaging	0.95
R7250:D630045J12Rik	UTSW	6	38142611	missense	possibly damaging	0.80
R7376:D630045J12Rik	UTSW	6	38174303	missense	probably damaging	0.99
R7491:D630045J12Rik	UTSW	6	38142666	missense	possibly damaging	0.89
R7552:D630045J12Rik	UTSW	6	38148448	missense	probably damaging	0.99
R7560:D630045J12Rik	UTSW	6	38196627	missense	possibly damaging	0.72
R7593:D630045J12Rik	UTSW	6	38195494	missense	possibly damaging	0.93
R7624:D630045J12Rik	UTSW	6	38149563	missense	probably damaging	1.00
R7654:D630045J12Rik	UTSW	6	38177701	missense	probably damaging	1.00
R8159:D630045J12Rik	UTSW	6	38128475	missense	probably damaging	0.99
R8167:D630045J12Rik	UTSW	6	38190549	critical splice donor site	probably null
R8189:D630045J12Rik	UTSW	6	38158171	missense	probably damaging	1.00
R8260:D630045J12Rik	UTSW	6	38142911	critical splice acceptor site	probably null
R8270:D630045J12Rik	UTSW	6	38190723	nonsense	probably null
R8331:D630045J12Rik	UTSW	6	38148474	missense	probably damaging	1.00
R8363:D630045J12Rik	UTSW	6	38148441	missense	probably damaging	1.00
R8365:D630045J12Rik	UTSW	6	38195635	missense	probably benign
R8492:D630045J12Rik	UTSW	6	38190590	missense	probably damaging	1.00
R8560:D630045J12Rik	UTSW	6	38149714	missense	probably damaging	1.00
R8987:D630045J12Rik	UTSW	6	38196963	missense	probably benign	0.11
R9052:D630045J12Rik	UTSW	6	38177609	missense	probably damaging	1.00
R9264:D630045J12Rik	UTSW	6	38158238	missense	probably benign	0.26
R9273:D630045J12Rik	UTSW	6	38190577	missense	possibly damaging	0.88
R9431:D630045J12Rik	UTSW	6	38196879	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- AACTGGAGAAGTCAACCGGC -3'
(R):5'- TGTGTTTCACGCTAACCACC -3'

Sequencing Primer
(F):5'- GAAGTCAACCGGCCCCCAG -3'
(R):5'- AACCACCCATTGTGTTTCACG -3'

Posted On

2014-10-30