Incidental Mutation 'R2354:Vmn2r44'
ID246823
Institutional Source Beutler Lab
Gene Symbol Vmn2r44
Ensembl Gene ENSMUSG00000094098
Gene Namevomeronasal 2, receptor 44
SynonymsEG434113
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2354 (G1)
Quality Score94
Status Not validated
Chromosome7
Chromosomal Location8366502-8383354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 8370640 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 517 (S517R)
Ref Sequence ENSEMBL: ENSMUSP00000132467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166499]
Predicted Effect probably damaging
Transcript: ENSMUST00000166499
AA Change: S517R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132467
Gene: ENSMUSG00000094098
AA Change: S517R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-34 PFAM
Pfam:NCD3G 512 565 3.8e-20 PFAM
Pfam:7tm_3 598 833 5.7e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Vmn2r44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Vmn2r44 APN 7 8380104 critical splice donor site probably null
IGL01723:Vmn2r44 APN 7 8377916 missense probably damaging 0.97
IGL01767:Vmn2r44 APN 7 8380238 missense probably benign 0.00
IGL02161:Vmn2r44 APN 7 8377815 missense possibly damaging 0.94
IGL02299:Vmn2r44 APN 7 8377816 missense probably benign
IGL02418:Vmn2r44 APN 7 8377865 missense probably damaging 1.00
IGL02829:Vmn2r44 APN 7 8377880 missense possibly damaging 0.94
IGL02851:Vmn2r44 APN 7 8383051 missense probably damaging 1.00
IGL03080:Vmn2r44 APN 7 8383245 utr 5 prime probably benign
R1471:Vmn2r44 UTSW 7 8377883 missense probably damaging 0.99
R1789:Vmn2r44 UTSW 7 8380123 missense possibly damaging 0.64
R1932:Vmn2r44 UTSW 7 8367982 missense probably benign 0.04
R4009:Vmn2r44 UTSW 7 8377988 missense possibly damaging 0.82
R4130:Vmn2r44 UTSW 7 8367919 missense probably damaging 1.00
R4790:Vmn2r44 UTSW 7 8367950 missense probably damaging 1.00
R4854:Vmn2r44 UTSW 7 8380301 missense possibly damaging 0.94
R4887:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R4888:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R5484:Vmn2r44 UTSW 7 8380124 missense possibly damaging 0.69
R6110:Vmn2r44 UTSW 7 8378006 missense probably damaging 1.00
R6357:Vmn2r44 UTSW 7 8370658 missense probably benign 0.01
R6526:Vmn2r44 UTSW 7 8378099 missense probably benign 0.01
R7083:Vmn2r44 UTSW 7 8378370 missense probably benign 0.44
R7087:Vmn2r44 UTSW 7 8378367 missense probably benign 0.02
R7115:Vmn2r44 UTSW 7 8367528 nonsense probably null
R7125:Vmn2r44 UTSW 7 8367942 missense probably damaging 1.00
R7258:Vmn2r44 UTSW 7 8377849 missense probably damaging 1.00
R7359:Vmn2r44 UTSW 7 8367539 missense probably benign 0.30
R7494:Vmn2r44 UTSW 7 8383123 nonsense probably null
R7766:Vmn2r44 UTSW 7 8368220 missense probably damaging 1.00
R7777:Vmn2r44 UTSW 7 8378315 missense possibly damaging 0.81
Z1177:Vmn2r44 UTSW 7 8367977 missense not run
Predicted Primers PCR Primer
(F):5'- ATCCCAGTGTGGACCAAGAG -3'
(R):5'- CTTCTGTAGATTTTACACACAGCTC -3'

Sequencing Primer
(F):5'- TCCCAGTGTGGACCAAGAGAAATC -3'
(R):5'- GCTCAAAAATCAGCTGTTTTTCCTG -3'
Posted On2014-10-30