Incidental Mutation 'R2354:Dyrk1b'
ID 246825
Institutional Source Beutler Lab
Gene Symbol Dyrk1b
Ensembl Gene ENSMUSG00000002409
Gene Name dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
Synonyms Mirk
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 28179469-28187294 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28185372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 404 (R404Q)
Ref Sequence ENSEMBL: ENSMUSP00000133431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]
AlphaFold Q9Z188
Predicted Effect possibly damaging
Transcript: ENSMUST00000085901
AA Change: R344Q

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: R344Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172467
AA Change: R404Q

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: R404Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172761
AA Change: R344Q

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409
AA Change: R344Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Dyrk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dyrk1b APN 7 28182676 missense probably damaging 0.96
IGL01820:Dyrk1b APN 7 28181600 utr 5 prime probably benign
IGL03155:Dyrk1b APN 7 28182687 missense probably benign 0.25
R0280:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R0323:Dyrk1b UTSW 7 28185356 missense probably benign 0.00
R0610:Dyrk1b UTSW 7 28186634 missense probably damaging 0.99
R0765:Dyrk1b UTSW 7 28185711 intron probably benign
R1858:Dyrk1b UTSW 7 28182646 splice site probably null
R4599:Dyrk1b UTSW 7 28182431 missense probably damaging 1.00
R4655:Dyrk1b UTSW 7 28185751 missense probably damaging 0.97
R5201:Dyrk1b UTSW 7 28185096 missense probably damaging 1.00
R5357:Dyrk1b UTSW 7 28185318 missense possibly damaging 0.79
R5560:Dyrk1b UTSW 7 28184253 missense possibly damaging 0.53
R6171:Dyrk1b UTSW 7 28186550 critical splice acceptor site probably null
R6751:Dyrk1b UTSW 7 28186709 missense probably damaging 1.00
R6901:Dyrk1b UTSW 7 28185117 missense probably damaging 1.00
R6918:Dyrk1b UTSW 7 28185925 missense probably damaging 0.99
R7699:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R7700:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R8177:Dyrk1b UTSW 7 28183176 missense possibly damaging 0.86
R8271:Dyrk1b UTSW 7 28182655 missense probably benign 0.02
R9241:Dyrk1b UTSW 7 28186633 missense probably benign 0.00
X0060:Dyrk1b UTSW 7 28183150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTCTAATGAGGTGTGCCC -3'
(R):5'- CAAGAGAGTGGCCGTCAGTG -3'

Sequencing Primer
(F):5'- CTAATGAGGTGTGCCCCTGGAAG -3'
(R):5'- CCGTCAGTGGGCAGGAG -3'
Posted On 2014-10-30