Incidental Mutation 'R2354:Ap3b2'
ID 246826
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms beta3B, Naptb
MMRRC Submission 040336-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 81460399-81493925 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 81473850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably benign
Transcript: ENSMUST00000082090
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125634
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8325:Ap3b2 UTSW 7 81484489 splice site probably null
R8355:Ap3b2 UTSW 7 81473103 missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81473035 missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81477183 missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81463798 missense unknown
R9304:Ap3b2 UTSW 7 81463271 missense unknown
R9321:Ap3b2 UTSW 7 81464504 critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81478009 missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81473903 missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81476344 missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAACTCATCATGCCAGAGATTAAG -3'
(R):5'- AGAGCTGCCCTGAGTATTGC -3'

Sequencing Primer
(F):5'- TGGGGAACTATGATGTCTCCAAACC -3'
(R):5'- AGCTGCCCTGAGTATTGCTTTCTAG -3'
Posted On 2014-10-30