Mutagenetix > Incidental Mutation

Incidental Mutation 'R2354:Umod'

246827

Institutional Source

Beutler Lab

Gene Symbol

Umod

Ensembl Gene

ENSMUSG00000030963

Gene Name

uromodulin

Synonyms

uromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein

MMRRC Submission

040336-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119462711-119479282 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119466193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 538 (V538M)

Ref Sequence

ENSEMBL: ENSMUSP00000146652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]

AlphaFold

Q91X17

Predicted Effect

probably damaging
Transcript: ENSMUST00000033263
AA Change: V538M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: V538M

Domain	Start	End	E-Value	Type
EGF	31	64	4.03e-1	SMART
EGF_CA	65	106	3.81e-11	SMART
EGF_CA	107	155	4.81e-8	SMART
Blast:ZP	256	325	6e-30	BLAST
ZP	335	586	2.19e-70	SMART
low complexity region	619	634	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208401

Predicted Effect

probably damaging
Transcript: ENSMUST00000209095
AA Change: V538M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2431

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Umod

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01151:Umod	APN	7	119477219	missense	possibly damaging	0.93
IGL02527:Umod	APN	7	119469467	missense	probably damaging	1.00
R0265:Umod	UTSW	7	119466073	missense	probably benign	0.00
R1073:Umod	UTSW	7	119464741	missense	possibly damaging	0.56
R1117:Umod	UTSW	7	119477306	missense	possibly damaging	0.71
R1515:Umod	UTSW	7	119465497	missense	probably benign	0.00
R1774:Umod	UTSW	7	119477351	missense	possibly damaging	0.82
R1803:Umod	UTSW	7	119464724	missense	probably damaging	0.96
R1864:Umod	UTSW	7	119463255	missense	probably damaging	0.99
R1942:Umod	UTSW	7	119476932	missense	probably damaging	1.00
R2060:Umod	UTSW	7	119476715	missense	probably damaging	0.97
R3015:Umod	UTSW	7	119472540	missense	probably damaging	1.00
R3030:Umod	UTSW	7	119476839	missense	probably benign	0.02
R4016:Umod	UTSW	7	119476690	missense	possibly damaging	0.56
R4406:Umod	UTSW	7	119466064	missense	probably damaging	1.00
R4446:Umod	UTSW	7	119466056	splice site	probably null
R5062:Umod	UTSW	7	119472421	nonsense	probably null
R5358:Umod	UTSW	7	119472354	missense	probably damaging	1.00
R5935:Umod	UTSW	7	119471427	missense	probably damaging	1.00
R6045:Umod	UTSW	7	119476823	missense	probably benign
R6239:Umod	UTSW	7	119477297	missense	probably damaging	1.00
R7111:Umod	UTSW	7	119477146	nonsense	probably null
R7168:Umod	UTSW	7	119478326	splice site	probably benign
R7265:Umod	UTSW	7	119466073	missense	probably benign	0.00
R7273:Umod	UTSW	7	119477027	missense	probably benign	0.16
R8749:Umod	UTSW	7	119471416	missense	probably benign	0.00
R8786:Umod	UTSW	7	119477358	missense	possibly damaging	0.76
R8939:Umod	UTSW	7	119469477	missense	probably damaging	1.00
R9320:Umod	UTSW	7	119466132	missense	probably damaging	1.00
R9689:Umod	UTSW	7	119477294	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GGCATCCAAGTGGGCTGTTATG -3'
(R):5'- TGTTCCAACTCTGTGGTTGAAG -3'

Sequencing Primer
(F):5'- GAAGGGCTTATGACTCACAGGTTTAC -3'
(R):5'- TTCTAGCCCCAAAGATACTGTGG -3'

Posted On

2014-10-30