Incidental Mutation 'R2354:Umod'
ID246827
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Nameuromodulin
Synonymsuromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2354 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119462711-119479282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119466193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 538 (V538M)
Ref Sequence ENSEMBL: ENSMUSP00000146652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]
Predicted Effect probably damaging
Transcript: ENSMUST00000033263
AA Change: V538M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: V538M

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208401
Predicted Effect probably damaging
Transcript: ENSMUST00000209095
AA Change: V538M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2431 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119477219 missense possibly damaging 0.93
IGL02527:Umod APN 7 119469467 missense probably damaging 1.00
R0265:Umod UTSW 7 119466073 missense probably benign 0.00
R1073:Umod UTSW 7 119464741 missense possibly damaging 0.56
R1117:Umod UTSW 7 119477306 missense possibly damaging 0.71
R1515:Umod UTSW 7 119465497 missense probably benign 0.00
R1774:Umod UTSW 7 119477351 missense possibly damaging 0.82
R1803:Umod UTSW 7 119464724 missense probably damaging 0.96
R1864:Umod UTSW 7 119463255 missense probably damaging 0.99
R1942:Umod UTSW 7 119476932 missense probably damaging 1.00
R2060:Umod UTSW 7 119476715 missense probably damaging 0.97
R3015:Umod UTSW 7 119472540 missense probably damaging 1.00
R3030:Umod UTSW 7 119476839 missense probably benign 0.02
R4016:Umod UTSW 7 119476690 missense possibly damaging 0.56
R4406:Umod UTSW 7 119466064 missense probably damaging 1.00
R4446:Umod UTSW 7 119466056 splice site probably null
R5062:Umod UTSW 7 119472421 nonsense probably null
R5358:Umod UTSW 7 119472354 missense probably damaging 1.00
R5935:Umod UTSW 7 119471427 missense probably damaging 1.00
R6045:Umod UTSW 7 119476823 missense probably benign
R6239:Umod UTSW 7 119477297 missense probably damaging 1.00
R7111:Umod UTSW 7 119477146 nonsense probably null
R7168:Umod UTSW 7 119478326 splice site probably benign
R7265:Umod UTSW 7 119466073 missense probably benign 0.00
R7273:Umod UTSW 7 119477027 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGCATCCAAGTGGGCTGTTATG -3'
(R):5'- TGTTCCAACTCTGTGGTTGAAG -3'

Sequencing Primer
(F):5'- GAAGGGCTTATGACTCACAGGTTTAC -3'
(R):5'- TTCTAGCCCCAAAGATACTGTGG -3'
Posted On2014-10-30