Incidental Mutation 'R2354:Tpcn2'
ID 246829
Institutional Source Beutler Lab
Gene Symbol Tpcn2
Ensembl Gene ENSMUSG00000048677
Gene Name two pore segment channel 2
Synonyms
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 145186524-145284011 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 145257218 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 581 (G581W)
Ref Sequence ENSEMBL: ENSMUSP00000061308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058022] [ENSMUST00000208148] [ENSMUST00000208328] [ENSMUST00000208841] [ENSMUST00000209047]
AlphaFold Q8BWC0
Predicted Effect probably damaging
Transcript: ENSMUST00000058022
AA Change: G581W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061308
Gene: ENSMUSG00000048677
AA Change: G581W

DomainStartEndE-ValueType
Pfam:Ion_trans 67 302 5.1e-24 PFAM
Pfam:Ion_trans 415 683 1.5e-29 PFAM
low complexity region 709 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208281
Predicted Effect probably benign
Transcript: ENSMUST00000208328
Predicted Effect probably benign
Transcript: ENSMUST00000208841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208867
Predicted Effect probably benign
Transcript: ENSMUST00000209047
Meta Mutation Damage Score 0.9223 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit altered beta cell calcium ion physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Tpcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Tpcn2 APN 7 145267378 missense probably damaging 1.00
IGL02112:Tpcn2 APN 7 145256792 missense probably benign 0.18
IGL02646:Tpcn2 APN 7 145258574 missense probably benign 0.03
R0385:Tpcn2 UTSW 7 145277174 missense probably damaging 1.00
R1441:Tpcn2 UTSW 7 145260134 missense probably benign
R1498:Tpcn2 UTSW 7 145268911 missense probably damaging 1.00
R1598:Tpcn2 UTSW 7 145277220 nonsense probably null
R2127:Tpcn2 UTSW 7 145273975 splice site probably benign
R3747:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3748:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3749:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R4775:Tpcn2 UTSW 7 145267342 missense probably damaging 1.00
R4835:Tpcn2 UTSW 7 145272351 missense probably damaging 0.98
R4931:Tpcn2 UTSW 7 145267309 missense probably benign 0.34
R4979:Tpcn2 UTSW 7 145260096 missense probably benign
R5185:Tpcn2 UTSW 7 145255454 missense probably damaging 1.00
R5418:Tpcn2 UTSW 7 145278781 missense probably damaging 1.00
R5443:Tpcn2 UTSW 7 145255472 missense possibly damaging 0.46
R5623:Tpcn2 UTSW 7 145267334 missense possibly damaging 0.76
R5716:Tpcn2 UTSW 7 145257813 missense possibly damaging 0.94
R5910:Tpcn2 UTSW 7 145260982 missense probably benign 0.01
R5927:Tpcn2 UTSW 7 145278784 missense probably damaging 0.99
R6015:Tpcn2 UTSW 7 145266851 missense probably damaging 1.00
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6299:Tpcn2 UTSW 7 145262243 missense probably damaging 1.00
R6337:Tpcn2 UTSW 7 145279343 missense probably damaging 1.00
R6382:Tpcn2 UTSW 7 145269749 missense possibly damaging 0.88
R6724:Tpcn2 UTSW 7 145256520 missense probably benign 0.00
R6995:Tpcn2 UTSW 7 145256785 missense probably benign 0.00
R7494:Tpcn2 UTSW 7 145278849 missense possibly damaging 0.91
R7942:Tpcn2 UTSW 7 145257191 missense probably damaging 0.99
R8052:Tpcn2 UTSW 7 145260946 missense probably benign 0.06
R8320:Tpcn2 UTSW 7 145266622 missense possibly damaging 0.75
R9131:Tpcn2 UTSW 7 145260925 missense probably damaging 1.00
Y4335:Tpcn2 UTSW 7 145257235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGTGTCAGCTTAGACCCTG -3'
(R):5'- ACAGAAGCTGAGATGTGCC -3'

Sequencing Primer
(F):5'- TCAGCTTAGACCCTGGGTGG -3'
(R):5'- TCTGTGGTAGCAGGCCTACAG -3'
Posted On 2014-10-30