Incidental Mutation 'R2354:Zfp358'
ID 246830
Institutional Source Beutler Lab
Gene Symbol Zfp358
Ensembl Gene ENSMUSG00000047264
Gene Name zinc finger protein 358
Synonyms Zfend
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3493138-3497208 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3495454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 12 (H12L)
Ref Sequence ENSEMBL: ENSMUSP00000146953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061508] [ENSMUST00000207318] [ENSMUST00000208423]
AlphaFold E9Q8M1
Predicted Effect possibly damaging
Transcript: ENSMUST00000061508
AA Change: H12L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060344
Gene: ENSMUSG00000047264
AA Change: H12L

DomainStartEndE-ValueType
low complexity region 24 49 N/A INTRINSIC
ZnF_C2H2 154 176 1.47e-3 SMART
ZnF_C2H2 182 204 2.95e-3 SMART
ZnF_C2H2 210 232 1.67e-2 SMART
ZnF_C2H2 238 260 3.63e-3 SMART
ZnF_C2H2 266 288 2.4e-3 SMART
ZnF_C2H2 294 316 1.4e-4 SMART
ZnF_C2H2 322 344 4.01e-5 SMART
ZnF_C2H2 350 372 2.4e-3 SMART
ZnF_C2H2 378 400 1.84e-4 SMART
low complexity region 422 430 N/A INTRINSIC
low complexity region 447 473 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207318
AA Change: H39L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208423
AA Change: H12L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1737 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Zfp358
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Zfp358 APN 8 3495663 missense probably benign 0.19
IGL02301:Zfp358 APN 8 3496858 missense probably benign
IGL02510:Zfp358 APN 8 3496786 missense probably benign 0.04
IGL02860:Zfp358 APN 8 3496074 missense probably damaging 1.00
R1018:Zfp358 UTSW 8 3496843 nonsense probably null
R1960:Zfp358 UTSW 8 3495742 missense possibly damaging 0.46
R2047:Zfp358 UTSW 8 3495934 missense probably damaging 1.00
R2202:Zfp358 UTSW 8 3496995 missense possibly damaging 0.80
R4688:Zfp358 UTSW 8 3495493 missense probably damaging 1.00
R4689:Zfp358 UTSW 8 3496146 splice site probably null
R4876:Zfp358 UTSW 8 3496170 missense probably damaging 0.98
R5830:Zfp358 UTSW 8 3495846 missense probably benign 0.36
R6589:Zfp358 UTSW 8 3495907 missense probably damaging 0.99
R6834:Zfp358 UTSW 8 3495613 missense probably benign 0.19
R9043:Zfp358 UTSW 8 3495810 missense probably benign 0.01
R9357:Zfp358 UTSW 8 3495568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCAAATCCTAGCTGGGAC -3'
(R):5'- TCTGCTTCAGGGTCCAGATC -3'

Sequencing Primer
(F):5'- GACACCGGTTAGGACTCTTC -3'
(R):5'- CAGGGTCCAGATCTTCTAAGCTG -3'
Posted On 2014-10-30