Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:Cep295'

246832

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

040336-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15334784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 792 (I792T)

Ref Sequence

ENSEMBL: ENSMUSP00000096578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000058041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066038

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098979
AA Change: I792T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: I792T

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160946

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: I792T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: I792T

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161795
AA Change: I744T

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: I744T

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162264

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
R8725:Cep295	UTSW	9	15332419	nonsense	probably null
R8919:Cep295	UTSW	9	15326711	missense	probably damaging	1.00
R9015:Cep295	UTSW	9	15332968	missense	probably benign	0.00
R9054:Cep295	UTSW	9	15324255	missense	possibly damaging	0.92
R9088:Cep295	UTSW	9	15322519	missense	probably benign	0.09
R9159:Cep295	UTSW	9	15341608	missense	probably benign	0.05
R9243:Cep295	UTSW	9	15332309	missense	probably benign	0.36
R9408:Cep295	UTSW	9	15333323	missense	probably benign	0.00
R9424:Cep295	UTSW	9	15333203	missense	probably damaging	0.98
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- TCTTAAGTCACCCTGCTGAGC -3'
(R):5'- ACGTCAGTGGCAGTTCTCTC -3'

Sequencing Primer
(F):5'- AGTCACCCTGCTGAGCTGTAATAG -3'
(R):5'- GCAGTTCTCTCAGGTGGAAAC -3'

Posted On

2014-10-30