Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:Neo1'

246833

Institutional Source

Beutler Lab

Gene Symbol

Neo1

Ensembl Gene

ENSMUSG00000032340

Gene Name

neogenin

Synonyms

2610028H22Rik, D930014N22Rik, Igdcc2

MMRRC Submission

040336-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58874687-59036441 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58985634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 242 (F242L)

Ref Sequence

ENSEMBL: ENSMUSP00000150600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068664
AA Change: F242L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: F242L

Domain	Start	End	E-Value	Type
signal peptide	1	41	N/A	INTRINSIC
IGc2	76	147	9.49e-5	SMART
IGc2	175	239	4.43e-5	SMART
IGc2	272	338	6.15e-13	SMART
IGc2	364	428	7.76e-10	SMART
low complexity region	446	458	N/A	INTRINSIC
FN3	470	553	8.23e-12	SMART
FN3	570	649	1.78e-16	SMART
FN3	665	749	1.54e-11	SMART
FN3	770	849	5.27e-10	SMART
FN3	885	970	7.63e-7	SMART
FN3	986	1072	2.78e-9	SMART
transmembrane domain	1136	1158	N/A	INTRINSIC
Pfam:Neogenin_C	1189	1492	1.9e-122	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214547
AA Change: F242L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215026

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216941

Predicted Effect

probably benign
Transcript: ENSMUST00000216964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217545

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Neo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Neo1	APN	9	58921919	splice site	probably benign
IGL00885:Neo1	APN	9	58888463	missense	probably damaging	1.00
IGL01103:Neo1	APN	9	58880799	missense	possibly damaging	0.60
IGL01322:Neo1	APN	9	58907085	missense	possibly damaging	0.68
IGL02216:Neo1	APN	9	58917053	missense	probably damaging	0.96
IGL02327:Neo1	APN	9	58903088	missense	probably benign	0.08
IGL02392:Neo1	APN	9	58925811	missense	possibly damaging	0.49
IGL02458:Neo1	APN	9	58893867	splice site	probably benign
IGL03057:Neo1	APN	9	58878059	missense	probably damaging	1.00
IGL03091:Neo1	APN	9	58978668	missense	probably damaging	0.98
IGL03193:Neo1	APN	9	58908484	missense	probably damaging	1.00
R0097:Neo1	UTSW	9	58882021	intron	probably benign
R0419:Neo1	UTSW	9	58990180	splice site	probably benign
R0571:Neo1	UTSW	9	58985786	missense	probably benign
R0646:Neo1	UTSW	9	58931034	missense	probably damaging	1.00
R0736:Neo1	UTSW	9	58917081	missense	possibly damaging	0.78
R0739:Neo1	UTSW	9	58921877	missense	probably benign	0.22
R1636:Neo1	UTSW	9	58913277	missense	probably damaging	1.00
R1694:Neo1	UTSW	9	58880603	missense	probably damaging	1.00
R1827:Neo1	UTSW	9	58917031	nonsense	probably null
R1927:Neo1	UTSW	9	58990385	missense	probably benign	0.12
R2365:Neo1	UTSW	9	58956003	missense	probably benign
R3156:Neo1	UTSW	9	58888979	splice site	probably null
R3552:Neo1	UTSW	9	58893878	missense	probably damaging	1.00
R3829:Neo1	UTSW	9	58913169	missense	possibly damaging	0.58
R4477:Neo1	UTSW	9	58877299	missense	probably damaging	0.99
R4613:Neo1	UTSW	9	58889041	missense	possibly damaging	0.94
R5023:Neo1	UTSW	9	58990271	missense	probably damaging	1.00
R5046:Neo1	UTSW	9	58893911	missense	possibly damaging	0.77
R5057:Neo1	UTSW	9	58990271	missense	probably damaging	1.00
R5323:Neo1	UTSW	9	58906648	critical splice donor site	probably null
R5394:Neo1	UTSW	9	58990234	missense	probably benign	0.10
R5470:Neo1	UTSW	9	58931067	missense	probably damaging	1.00
R5473:Neo1	UTSW	9	58880843	missense	possibly damaging	0.88
R5500:Neo1	UTSW	9	58917054	missense	possibly damaging	0.94
R5503:Neo1	UTSW	9	58985650	missense	possibly damaging	0.67
R6122:Neo1	UTSW	9	58917008	missense	probably benign
R6191:Neo1	UTSW	9	58889029	missense	probably damaging	1.00
R6431:Neo1	UTSW	9	58907071	missense	probably benign	0.27
R6560:Neo1	UTSW	9	58880601	missense	possibly damaging	0.95
R6658:Neo1	UTSW	9	58921849	missense	probably benign	0.14
R6772:Neo1	UTSW	9	58902976	missense	probably damaging	1.00
R6912:Neo1	UTSW	9	58917052	missense	probably benign	0.00
R7061:Neo1	UTSW	9	58990441	missense	possibly damaging	0.95
R7145:Neo1	UTSW	9	58889179	missense	probably damaging	1.00
R7156:Neo1	UTSW	9	58902923	missense	probably damaging	1.00
R7485:Neo1	UTSW	9	58884543	missense	probably benign	0.04
R7519:Neo1	UTSW	9	58878065	missense	probably benign	0.13
R7615:Neo1	UTSW	9	58884503	missense	probably benign	0.07
R7665:Neo1	UTSW	9	58925795	missense	probably damaging	1.00
R7695:Neo1	UTSW	9	58902929	missense	possibly damaging	0.81
R7753:Neo1	UTSW	9	58956005	missense	probably benign	0.00
R7807:Neo1	UTSW	9	58990494	missense	probably benign	0.01
R7915:Neo1	UTSW	9	58930981	missense	probably benign	0.42
R7973:Neo1	UTSW	9	58990193	missense	probably damaging	1.00
R8356:Neo1	UTSW	9	58878119	missense	probably damaging	1.00
R8505:Neo1	UTSW	9	58913283	missense	probably benign	0.02
R8700:Neo1	UTSW	9	58918630	missense	probably benign	0.28
R8798:Neo1	UTSW	9	58913166	missense	probably damaging	1.00
R8952:Neo1	UTSW	9	58990262	missense	probably benign	0.01
X0063:Neo1	UTSW	9	58990298	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACTACACCTGGCTTTGAACAG -3'
(R):5'- CAGTCTATGTTGGAAACAGTGC -3'

Sequencing Primer
(F):5'- GAACAGTGAATTTTTATGGCCCCTC -3'
(R):5'- TGTTGGAAACAGTGCAATTCTG -3'

Posted On

2014-10-30