Mutagenetix > Incidental Mutation

Incidental Mutation 'R2354:Zkscan7'

246834

Institutional Source

Beutler Lab

Gene Symbol

Zkscan7

Ensembl Gene

ENSMUSG00000063488

Gene Name

zinc finger with KRAB and SCAN domains 7

Synonyms

Zfp167

MMRRC Submission

040336-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122885685-122898618 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122894827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 287 (D287G)

Ref Sequence

ENSEMBL: ENSMUSP00000071695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063980] [ENSMUST00000215872]

AlphaFold

E9PVW1

Predicted Effect

probably benign
Transcript: ENSMUST00000063980
AA Change: D287G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071695
Gene: ENSMUSG00000063488
AA Change: D287G

Domain	Start	End	E-Value	Type
SCAN	45	156	1.18e-65	SMART
ZnF_C2H2	350	372	5.59e-4	SMART
ZnF_C2H2	378	400	3.69e-4	SMART
ZnF_C2H2	434	456	8.4e1	SMART
ZnF_C2H2	487	509	4.24e-4	SMART
ZnF_C2H2	515	537	8.34e-3	SMART
ZnF_C2H2	543	565	7.37e-4	SMART
ZnF_C2H2	571	593	1.92e-2	SMART
ZnF_C2H2	599	621	1.13e-4	SMART
ZnF_C2H2	627	649	2.24e-3	SMART
ZnF_C2H2	655	677	4.17e-3	SMART
ZnF_C2H2	683	705	1.04e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180486

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180877

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214426

Predicted Effect

probably benign
Transcript: ENSMUST00000215872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216429

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216924

Meta Mutation Damage Score

0.0746

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het

Other mutations in Zkscan7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Zkscan7	APN	9	122895594	missense	possibly damaging	0.95
IGL01650:Zkscan7	APN	9	122894827	missense	probably benign
IGL01905:Zkscan7	APN	9	122890761	missense	possibly damaging	0.93
IGL02466:Zkscan7	APN	9	122888885	missense	probably damaging	0.98
R0310:Zkscan7	UTSW	9	122888893	nonsense	probably null
R0355:Zkscan7	UTSW	9	122888807	missense	probably damaging	1.00
R0477:Zkscan7	UTSW	9	122890809	splice site	probably null
R1276:Zkscan7	UTSW	9	122890723	missense	probably damaging	0.98
R1426:Zkscan7	UTSW	9	122895163	missense	probably benign
R2055:Zkscan7	UTSW	9	122888937	missense	probably damaging	1.00
R2195:Zkscan7	UTSW	9	122895621	missense	possibly damaging	0.73
R4878:Zkscan7	UTSW	9	122890800	nonsense	probably null
R5106:Zkscan7	UTSW	9	122896133	unclassified	probably benign
R6266:Zkscan7	UTSW	9	122895234	nonsense	probably null
R6299:Zkscan7	UTSW	9	122888717	missense	probably damaging	1.00
R6513:Zkscan7	UTSW	9	122896105	missense	probably benign	0.00
R6881:Zkscan7	UTSW	9	122888701	missense	possibly damaging	0.96
R7640:Zkscan7	UTSW	9	122896056	missense	possibly damaging	0.71
R7920:Zkscan7	UTSW	9	122895909	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TGGACCATTGTTCCTCTGTG -3'
(R):5'- TTCTCCCTGATGCTCAACAG -3'

Sequencing Primer
(F):5'- CCTCTGTGTTTTAATATCCCTGAAG -3'
(R):5'- CTGATGCTCAACAGGACTGG -3'

Posted On

2014-10-30