Incidental Mutation 'R2354:Zc3h12d'
ID246835
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2354 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7867938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 491 (V491L)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably benign
Transcript: ENSMUST00000039484
AA Change: V491L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: V491L

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6409:Zc3h12d UTSW 10 7867318 missense probably benign 0.04
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6903:Zc3h12d UTSW 10 7867661 missense probably benign
R6967:Zc3h12d UTSW 10 7839880 missense probably damaging 1.00
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7594:Zc3h12d UTSW 10 7862618 missense probably damaging 1.00
R7622:Zc3h12d UTSW 10 7867269 missense probably damaging 1.00
R7645:Zc3h12d UTSW 10 7867576 missense probably benign
R7769:Zc3h12d UTSW 10 7867626 missense probably benign 0.03
R7864:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
R7947:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCCAGGGACATGCACAGTG -3'
(R):5'- AACGGCGTCCAACCTAATG -3'

Sequencing Primer
(F):5'- ATGCACAGTGACCTGCCTC -3'
(R):5'- TCCAGACTAACAAGCGTCTTG -3'
Posted On2014-10-30