Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:Zc3h12d'

246835

Institutional Source

Beutler Lab

Gene Symbol

Zc3h12d

Ensembl Gene

ENSMUSG00000039981

Gene Name

zinc finger CCCH type containing 12D

Synonyms

D730019B10Rik, TFL

MMRRC Submission

040336-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7832470-7870396 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 7867938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 491 (V491L)

Ref Sequence

ENSEMBL: ENSMUSP00000040217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039484]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039484
AA Change: V491L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: V491L

Domain	Start	End	E-Value	Type
Pfam:RNase_Zc3h12a	91	247	4e-67	PFAM
low complexity region	333	345	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Zc3h12d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Zc3h12d	APN	10	7862467	missense	probably damaging	1.00
IGL01013:Zc3h12d	APN	10	7839956	missense	probably damaging	1.00
IGL02090:Zc3h12d	APN	10	7867332	missense	probably benign	0.00
IGL02876:Zc3h12d	APN	10	7862600	missense	probably damaging	0.99
R0040:Zc3h12d	UTSW	10	7867914	missense	probably benign	0.02
R0040:Zc3h12d	UTSW	10	7867914	missense	probably benign	0.02
R0242:Zc3h12d	UTSW	10	7862566	missense	probably damaging	1.00
R0242:Zc3h12d	UTSW	10	7862566	missense	probably damaging	1.00
R1942:Zc3h12d	UTSW	10	7853313	missense	probably damaging	1.00
R2290:Zc3h12d	UTSW	10	7867459	missense	probably benign	0.00
R4816:Zc3h12d	UTSW	10	7867947	missense	probably damaging	1.00
R4932:Zc3h12d	UTSW	10	7853250	missense	probably damaging	0.99
R5191:Zc3h12d	UTSW	10	7867818	missense	possibly damaging	0.51
R5384:Zc3h12d	UTSW	10	7853250	missense	probably damaging	1.00
R5396:Zc3h12d	UTSW	10	7866326	missense	probably damaging	1.00
R6409:Zc3h12d	UTSW	10	7867318	missense	probably benign	0.04
R6877:Zc3h12d	UTSW	10	7839971	missense	probably damaging	0.99
R6903:Zc3h12d	UTSW	10	7867661	missense	probably benign
R6967:Zc3h12d	UTSW	10	7839880	missense	probably damaging	1.00
R7312:Zc3h12d	UTSW	10	7867581	missense	probably benign	0.00
R7594:Zc3h12d	UTSW	10	7862618	missense	probably damaging	1.00
R7622:Zc3h12d	UTSW	10	7867269	missense	probably damaging	1.00
R7645:Zc3h12d	UTSW	10	7867576	missense	probably benign
R7769:Zc3h12d	UTSW	10	7867626	missense	probably benign	0.03
R7864:Zc3h12d	UTSW	10	7839959	missense	possibly damaging	0.83
R8371:Zc3h12d	UTSW	10	7839971	frame shift	probably null
R8414:Zc3h12d	UTSW	10	7839971	frame shift	probably null
R9255:Zc3h12d	UTSW	10	7853258	missense	probably damaging	1.00
Z1177:Zc3h12d	UTSW	10	7867808	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCAGGGACATGCACAGTG -3'
(R):5'- AACGGCGTCCAACCTAATG -3'

Sequencing Primer
(F):5'- ATGCACAGTGACCTGCCTC -3'
(R):5'- TCCAGACTAACAAGCGTCTTG -3'

Posted On

2014-10-30