Incidental Mutation 'R2354:4930444G20Rik'
ID 246836
Institutional Source Beutler Lab
Gene Symbol 4930444G20Rik
Ensembl Gene ENSMUSG00000069712
Gene Name RIKEN cDNA 4930444G20 gene
Synonyms
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R2354 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 22066307-22068079 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22067256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 275 (T275K)
Ref Sequence ENSEMBL: ENSMUSP00000097613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092672]
AlphaFold D3Z741
Predicted Effect probably benign
Transcript: ENSMUST00000092672
AA Change: T275K

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097613
Gene: ENSMUSG00000069712
AA Change: T275K

DomainStartEndE-ValueType
low complexity region 194 205 N/A INTRINSIC
Pfam:Peptidase_C48 315 494 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in 4930444G20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:4930444G20Rik APN 10 22067277 missense probably benign 0.01
IGL02546:4930444G20Rik APN 10 22066927 missense probably damaging 1.00
IGL02885:4930444G20Rik APN 10 22067158 missense possibly damaging 0.94
R0543:4930444G20Rik UTSW 10 22066924 missense possibly damaging 0.88
R1762:4930444G20Rik UTSW 10 22067512 missense probably benign 0.02
R2249:4930444G20Rik UTSW 10 22067116 missense possibly damaging 0.77
R2870:4930444G20Rik UTSW 10 22067379 missense probably benign
R2870:4930444G20Rik UTSW 10 22067379 missense probably benign
R3777:4930444G20Rik UTSW 10 22066962 missense probably damaging 1.00
R4117:4930444G20Rik UTSW 10 22067716 missense probably benign
R4644:4930444G20Rik UTSW 10 22066761 missense probably benign 0.02
R5002:4930444G20Rik UTSW 10 22067817 missense probably damaging 0.99
R5667:4930444G20Rik UTSW 10 22066843 missense possibly damaging 0.91
R5671:4930444G20Rik UTSW 10 22066843 missense possibly damaging 0.91
R6694:4930444G20Rik UTSW 10 22067721 missense probably damaging 0.99
R6810:4930444G20Rik UTSW 10 22066717 missense probably damaging 1.00
R6923:4930444G20Rik UTSW 10 22067755 missense probably damaging 1.00
R6942:4930444G20Rik UTSW 10 22067261 missense probably benign
R7065:4930444G20Rik UTSW 10 22067298 missense probably benign 0.00
R7204:4930444G20Rik UTSW 10 22067886 missense probably damaging 1.00
R8778:4930444G20Rik UTSW 10 22067457 missense probably damaging 0.99
R9403:4930444G20Rik UTSW 10 22067941 missense possibly damaging 0.65
R9416:4930444G20Rik UTSW 10 22067853 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTAAAGACATGCAGAGCCGG -3'
(R):5'- AGTGCTGTTCTGAGGAGAAATG -3'

Sequencing Primer
(F):5'- GGTTTTCATTTCTCTCAACCAGAAGG -3'
(R):5'- CTGTTCTGAGGAGAAATGTGTTACAG -3'
Posted On 2014-10-30