Mutagenetix > Incidental Mutations

Incidental Mutation 'R2354:Mtr'

246840

Institutional Source

Beutler Lab

Gene Symbol

Mtr

Ensembl Gene

ENSMUSG00000021311

Gene Name

5-methyltetrahydrofolate-homocysteine methyltransferase

Synonyms

methionine synthase, D830038K18Rik, MS

MMRRC Submission

040336-MU

Accession Numbers

Genbank: NM_001081128

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2354 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

12182712-12258113 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 12188157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099856]

AlphaFold

A6H5Y3

Predicted Effect

probably benign
Transcript: ENSMUST00000099856

SMART Domains

Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311

Domain	Start	End	E-Value	Type
Pfam:S-methyl_trans	18	326	1.5e-93	PFAM
Pfam:Pterin_bind	363	601	4.6e-63	PFAM
B12-binding_2	657	743	6.42e-41	SMART
Pfam:B12-binding	761	861	3.3e-20	PFAM
Pfam:Met_synt_B12	953	1234	2.5e-114	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221190

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Pitpnm2	A	T	5: 124,122,919	V1010E	probably damaging	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Mtr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01299:Mtr	APN	13	12225650	splice site	probably benign
IGL02456:Mtr	APN	13	12199094	missense	probably damaging	0.98
IGL02573:Mtr	APN	13	12199127	missense	possibly damaging	0.95
IGL02642:Mtr	APN	13	12195232	splice site	probably benign
IGL03005:Mtr	APN	13	12235449	splice site	probably benign
IGL03017:Mtr	APN	13	12247891	critical splice donor site	probably null
IGL03036:Mtr	APN	13	12247377	missense	probably damaging	1.00
H8930:Mtr	UTSW	13	12235460	missense	probably damaging	1.00
PIT4431001:Mtr	UTSW	13	12212443	missense	probably damaging	1.00
PIT4520001:Mtr	UTSW	13	12197985	nonsense	probably null
R0011:Mtr	UTSW	13	12238052	splice site	probably benign
R0047:Mtr	UTSW	13	12222226	missense	probably damaging	1.00
R0047:Mtr	UTSW	13	12222226	missense	probably damaging	1.00
R0304:Mtr	UTSW	13	12222154	critical splice donor site	probably null
R0617:Mtr	UTSW	13	12221432	missense	probably benign
R0842:Mtr	UTSW	13	12200247	missense	probably damaging	1.00
R1101:Mtr	UTSW	13	12189525	missense	possibly damaging	0.84
R1450:Mtr	UTSW	13	12193733	missense	probably damaging	0.99
R1534:Mtr	UTSW	13	12235544	splice site	probably benign
R1907:Mtr	UTSW	13	12225532	missense	probably damaging	1.00
R2111:Mtr	UTSW	13	12244601	missense	possibly damaging	0.86
R3849:Mtr	UTSW	13	12247365	missense	probably benign	0.16
R3899:Mtr	UTSW	13	12216849	missense	probably benign	0.00
R4012:Mtr	UTSW	13	12189397	missense	probably damaging	1.00
R4012:Mtr	UTSW	13	12189398	missense	probably damaging	1.00
R4075:Mtr	UTSW	13	12215412	critical splice donor site	probably null
R4091:Mtr	UTSW	13	12231057	missense	probably damaging	1.00
R4655:Mtr	UTSW	13	12227793	missense	probably damaging	1.00
R4801:Mtr	UTSW	13	12195251	missense	probably benign	0.01
R4802:Mtr	UTSW	13	12195251	missense	probably benign	0.01
R4895:Mtr	UTSW	13	12216866	missense	probably benign	0.01
R5481:Mtr	UTSW	13	12188155	critical splice acceptor site	probably null
R5966:Mtr	UTSW	13	12215567	critical splice acceptor site	probably null
R6209:Mtr	UTSW	13	12190392	missense	probably benign	0.00
R6348:Mtr	UTSW	13	12247954	missense	possibly damaging	0.49
R6463:Mtr	UTSW	13	12216866	missense	probably benign	0.01
R6467:Mtr	UTSW	13	12188106	missense	probably damaging	1.00
R7046:Mtr	UTSW	13	12190209	missense	possibly damaging	0.58
R7505:Mtr	UTSW	13	12221476	missense	probably benign	0.02
R7575:Mtr	UTSW	13	12199077	missense	probably benign	0.01
R7705:Mtr	UTSW	13	12249896	missense	probably benign
R7748:Mtr	UTSW	13	12227839	missense	probably benign	0.00
R8161:Mtr	UTSW	13	12221486	missense	probably damaging	0.99
R8290:Mtr	UTSW	13	12190253	missense	probably damaging	1.00
R8988:Mtr	UTSW	13	12235479	missense	probably benign
R9050:Mtr	UTSW	13	12216862	missense	probably null	0.67
R9420:Mtr	UTSW	13	12253878	missense	probably benign	0.04
X0064:Mtr	UTSW	13	12250657	missense	probably damaging	1.00
Z1177:Mtr	UTSW	13	12187049	missense	probably benign	0.32
Z1177:Mtr	UTSW	13	12249866	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAAATAGATCCTACGGGTCCATC -3'
(R):5'- AATCGGAGCCTCTAACCCTG -3'

Sequencing Primer
(F):5'- CGGGTCCATCTAAAGACAGTTATGC -3'
(R):5'- GGATGAAAGTCTTTCCCAGGC -3'

Posted On

2014-10-30