Incidental Mutation 'R2354:Mtr'
ID 246840
Institutional Source Beutler Lab
Gene Symbol Mtr
Ensembl Gene ENSMUSG00000021311
Gene Name 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms methionine synthase, D830038K18Rik, MS
MMRRC Submission 040336-MU
Accession Numbers

Genbank: NM_001081128

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2354 (G1)
Quality Score 217
Status Validated
Chromosome 13
Chromosomal Location 12182712-12258113 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 12188157 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099856]
AlphaFold A6H5Y3
Predicted Effect probably benign
Transcript: ENSMUST00000099856
SMART Domains Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311

DomainStartEndE-ValueType
Pfam:S-methyl_trans 18 326 1.5e-93 PFAM
Pfam:Pterin_bind 363 601 4.6e-63 PFAM
B12-binding_2 657 743 6.42e-41 SMART
Pfam:B12-binding 761 861 3.3e-20 PFAM
Pfam:Met_synt_B12 953 1234 2.5e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221190
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Mtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Mtr APN 13 12225650 splice site probably benign
IGL02456:Mtr APN 13 12199094 missense probably damaging 0.98
IGL02573:Mtr APN 13 12199127 missense possibly damaging 0.95
IGL02642:Mtr APN 13 12195232 splice site probably benign
IGL03005:Mtr APN 13 12235449 splice site probably benign
IGL03017:Mtr APN 13 12247891 critical splice donor site probably null
IGL03036:Mtr APN 13 12247377 missense probably damaging 1.00
H8930:Mtr UTSW 13 12235460 missense probably damaging 1.00
PIT4431001:Mtr UTSW 13 12212443 missense probably damaging 1.00
PIT4520001:Mtr UTSW 13 12197985 nonsense probably null
R0011:Mtr UTSW 13 12238052 splice site probably benign
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0304:Mtr UTSW 13 12222154 critical splice donor site probably null
R0617:Mtr UTSW 13 12221432 missense probably benign
R0842:Mtr UTSW 13 12200247 missense probably damaging 1.00
R1101:Mtr UTSW 13 12189525 missense possibly damaging 0.84
R1450:Mtr UTSW 13 12193733 missense probably damaging 0.99
R1534:Mtr UTSW 13 12235544 splice site probably benign
R1907:Mtr UTSW 13 12225532 missense probably damaging 1.00
R2111:Mtr UTSW 13 12244601 missense possibly damaging 0.86
R3849:Mtr UTSW 13 12247365 missense probably benign 0.16
R3899:Mtr UTSW 13 12216849 missense probably benign 0.00
R4012:Mtr UTSW 13 12189397 missense probably damaging 1.00
R4012:Mtr UTSW 13 12189398 missense probably damaging 1.00
R4075:Mtr UTSW 13 12215412 critical splice donor site probably null
R4091:Mtr UTSW 13 12231057 missense probably damaging 1.00
R4655:Mtr UTSW 13 12227793 missense probably damaging 1.00
R4801:Mtr UTSW 13 12195251 missense probably benign 0.01
R4802:Mtr UTSW 13 12195251 missense probably benign 0.01
R4895:Mtr UTSW 13 12216866 missense probably benign 0.01
R5481:Mtr UTSW 13 12188155 critical splice acceptor site probably null
R5966:Mtr UTSW 13 12215567 critical splice acceptor site probably null
R6209:Mtr UTSW 13 12190392 missense probably benign 0.00
R6348:Mtr UTSW 13 12247954 missense possibly damaging 0.49
R6463:Mtr UTSW 13 12216866 missense probably benign 0.01
R6467:Mtr UTSW 13 12188106 missense probably damaging 1.00
R7046:Mtr UTSW 13 12190209 missense possibly damaging 0.58
R7505:Mtr UTSW 13 12221476 missense probably benign 0.02
R7575:Mtr UTSW 13 12199077 missense probably benign 0.01
R7705:Mtr UTSW 13 12249896 missense probably benign
R7748:Mtr UTSW 13 12227839 missense probably benign 0.00
R8161:Mtr UTSW 13 12221486 missense probably damaging 0.99
R8290:Mtr UTSW 13 12190253 missense probably damaging 1.00
R8988:Mtr UTSW 13 12235479 missense probably benign
R9050:Mtr UTSW 13 12216862 missense probably null 0.67
R9420:Mtr UTSW 13 12253878 missense probably benign 0.04
X0064:Mtr UTSW 13 12250657 missense probably damaging 1.00
Z1177:Mtr UTSW 13 12187049 missense probably benign 0.32
Z1177:Mtr UTSW 13 12249866 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAAATAGATCCTACGGGTCCATC -3'
(R):5'- AATCGGAGCCTCTAACCCTG -3'

Sequencing Primer
(F):5'- CGGGTCCATCTAAAGACAGTTATGC -3'
(R):5'- GGATGAAAGTCTTTCCCAGGC -3'
Posted On 2014-10-30