Incidental Mutation 'R2354:Gm6169'
ID 246842
Institutional Source Beutler Lab
Gene Symbol Gm6169
Ensembl Gene ENSMUSG00000057762
Gene Name predicted gene 6169
Synonyms
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 97098208-97099237 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97098801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 146 (T146I)
Ref Sequence ENSEMBL: ENSMUSP00000132645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042517] [ENSMUST00000071118] [ENSMUST00000169863]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042517
SMART Domains Protein: ENSMUSP00000043738
Gene: ENSMUSG00000041817

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071118
AA Change: T146I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132645
Gene: ENSMUSG00000057762
AA Change: T146I

DomainStartEndE-ValueType
Pfam:MARVEL 19 132 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169863
SMART Domains Protein: ENSMUSP00000126209
Gene: ENSMUSG00000041817

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Gm6169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Gm6169 APN 13 97098777 intron probably benign
IGL02151:Gm6169 APN 13 97099174 missense probably null 0.00
R2101:Gm6169 UTSW 13 97099222 missense probably damaging 0.97
R2248:Gm6169 UTSW 13 97098898 missense possibly damaging 0.76
R5027:Gm6169 UTSW 13 97099140 missense probably benign 0.25
R5664:Gm6169 UTSW 13 97099121 missense probably damaging 1.00
R5931:Gm6169 UTSW 13 97099197 missense probably benign 0.01
R8466:Gm6169 UTSW 13 97098984 missense probably damaging 1.00
R9428:Gm6169 UTSW 13 97099216 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTGGAGTGTTGTGGAAACC -3'
(R):5'- CAACTGGCCTTGGACTGACTTC -3'

Sequencing Primer
(F):5'- AGACAGGATCTCACTGTGTAGCC -3'
(R):5'- GACTTCTTCAGATCCCTCATAGCAAC -3'
Posted On 2014-10-30