Incidental Mutation 'R2354:Nadk2'
ID 246843
Institutional Source Beutler Lab
Gene Symbol Nadk2
Ensembl Gene ENSMUSG00000022253
Gene Name NAD kinase 2, mitochondrial
Synonyms 4933430B08Rik, 1110020G09Rik, MNADK, Nadkd1
MMRRC Submission 040336-MU
Accession Numbers

Genbank: NM_001040395; MGI: 1915896

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 9071260-9110891 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9085782 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 167 (I167N)
Ref Sequence ENSEMBL: ENSMUSP00000098353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067760] [ENSMUST00000100789] [ENSMUST00000100790]
AlphaFold Q8C5H8
Predicted Effect probably damaging
Transcript: ENSMUST00000067760
AA Change: I167N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068318
Gene: ENSMUSG00000022253
AA Change: I167N

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 334 4.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100789
AA Change: I167N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098353
Gene: ENSMUSG00000022253
AA Change: I167N

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 171 8.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100790
AA Change: I167N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098354
Gene: ENSMUSG00000022253
AA Change: I167N

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 312 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228397
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial kinase that catalyzes the phosphorylation of NAD to yield NADP. Mutations in this gene result in 2,4-dienoyl-CoA reductase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for knock-out allele exhibit increased serum lysine and carnitine levels, develop increased reactive oxygen species levels and hepatic steatosis on an atherogenic high-fat diet, and show impaired fasting-induced fatty acid oxidation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Nadk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Nadk2 APN 15 9102984 missense probably damaging 1.00
tabak UTSW 15 9108254 missense probably damaging 0.99
PIT4131001:Nadk2 UTSW 15 9100143 frame shift probably null
PIT4142001:Nadk2 UTSW 15 9100143 frame shift probably null
R0347:Nadk2 UTSW 15 9084207 missense probably benign 0.08
R0838:Nadk2 UTSW 15 9091242 missense probably benign 0.00
R0988:Nadk2 UTSW 15 9102992 missense probably damaging 0.99
R1014:Nadk2 UTSW 15 9091254 missense probably damaging 1.00
R1159:Nadk2 UTSW 15 9106837 missense possibly damaging 0.86
R1387:Nadk2 UTSW 15 9106782 missense possibly damaging 0.68
R1861:Nadk2 UTSW 15 9108311 missense probably benign 0.21
R1886:Nadk2 UTSW 15 9103358 missense possibly damaging 0.87
R3623:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R3624:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R4642:Nadk2 UTSW 15 9092721 missense possibly damaging 0.64
R4867:Nadk2 UTSW 15 9098857 missense possibly damaging 0.84
R5314:Nadk2 UTSW 15 9108313 missense probably benign 0.04
R7214:Nadk2 UTSW 15 9108254 missense probably damaging 0.99
R7244:Nadk2 UTSW 15 9083191 splice site probably null
R7310:Nadk2 UTSW 15 9103381 critical splice donor site probably null
R7634:Nadk2 UTSW 15 9092846 missense probably benign 0.41
R8310:Nadk2 UTSW 15 9103332 missense probably benign
R8424:Nadk2 UTSW 15 9083334 missense possibly damaging 0.92
R9265:Nadk2 UTSW 15 9071694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCAGCACAGTACAACAG -3'
(R):5'- ACAGAGCCTACGTCATGAGC -3'

Sequencing Primer
(F):5'- TCAGCACAGTACAACAGGCATAGG -3'
(R):5'- GAGCCTACGTCATGAGCACCAG -3'
Posted On 2014-10-30