Incidental Mutation 'R2354:Cd226'
ID 246847
Institutional Source Beutler Lab
Gene Symbol Cd226
Ensembl Gene ENSMUSG00000034028
Gene Name CD226 antigen
Synonyms TLiSA1, DNAM-1, Pta1, DNAM1
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 89197431-89270201 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 89246983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037142] [ENSMUST00000037142] [ENSMUST00000097496] [ENSMUST00000097496]
AlphaFold Q8K4F0
Predicted Effect probably null
Transcript: ENSMUST00000037142
SMART Domains Protein: ENSMUSP00000043551
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 126 4.46e-1 SMART
IG 138 243 9.26e-8 SMART
transmembrane domain 252 274 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037142
SMART Domains Protein: ENSMUSP00000043551
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 126 4.46e-1 SMART
IG 138 243 9.26e-8 SMART
transmembrane domain 252 274 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097496
SMART Domains Protein: ENSMUSP00000095104
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
IG 25 130 9.26e-8 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097496
SMART Domains Protein: ENSMUSP00000095104
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
IG 25 130 9.26e-8 SMART
transmembrane domain 139 161 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and increased incidence of tumor formation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Cd226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Cd226 APN 18 89269063 missense probably damaging 1.00
IGL02292:Cd226 APN 18 89207092 missense possibly damaging 0.55
IGL02298:Cd226 APN 18 89207051 missense probably damaging 1.00
IGL02408:Cd226 APN 18 89207327 missense probably benign
R0179:Cd226 UTSW 18 89207139 missense probably benign 0.00
R0558:Cd226 UTSW 18 89207214 missense probably benign 0.30
R0602:Cd226 UTSW 18 89269011 missense probably benign 0.00
R0744:Cd226 UTSW 18 89207020 intron probably benign
R0833:Cd226 UTSW 18 89207020 intron probably benign
R1125:Cd226 UTSW 18 89267922 missense probably benign
R1352:Cd226 UTSW 18 89247174 missense probably damaging 1.00
R1355:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1370:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1998:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R2004:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2006:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2045:Cd226 UTSW 18 89207362 missense probably benign 0.10
R2518:Cd226 UTSW 18 89207327 missense probably benign
R4603:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R4804:Cd226 UTSW 18 89207168 missense possibly damaging 0.89
R5964:Cd226 UTSW 18 89207183 missense probably benign 0.02
R5999:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R7205:Cd226 UTSW 18 89247198 missense probably damaging 1.00
R7456:Cd226 UTSW 18 89206623 missense probably damaging 0.96
R7509:Cd226 UTSW 18 89247071 missense probably benign 0.10
R7714:Cd226 UTSW 18 89247309 missense probably damaging 1.00
R9127:Cd226 UTSW 18 89269031 missense probably damaging 1.00
X0024:Cd226 UTSW 18 89263285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTACCCTGGGTTTCAGTTATG -3'
(R):5'- TCTTGAGATAGGTTACAGGAAGC -3'

Sequencing Primer
(F):5'- ACCCTGGGTTTCAGTTATGTTTCTAG -3'
(R):5'- TACAGGAAGCTAAGATGTCTACCTG -3'
Posted On 2014-10-30