Incidental Mutation 'R2355:M1ap'
ID 246867
Institutional Source Beutler Lab
Gene Symbol M1ap
Ensembl Gene ENSMUSG00000030041
Gene Name meiosis 1 associated protein
Synonyms D6Mm5e
MMRRC Submission 040337-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R2355 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 82946902-83030309 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82956503 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 13 (A13T)
Ref Sequence ENSEMBL: ENSMUSP00000109613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113980]
AlphaFold Q9Z0E1
Predicted Effect probably benign
Transcript: ENSMUST00000113980
AA Change: A13T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109613
Gene: ENSMUSG00000030041
AA Change: A13T

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 482 500 N/A INTRINSIC
low complexity region 504 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203190
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is likely to function in progression of meiosis. A similar protein in mouse plays a role in gametogenesis in both sexes. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility with oligospermia, globozooaspermiam decreased testies weight and size, degeneration of seminiferous tubules, male germ cell apoptosis and arrested male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Ahcyl1 A G 3: 107,670,217 S296P probably damaging Het
Alas1 A G 9: 106,236,474 V524A probably damaging Het
Amn C A 12: 111,271,812 D53E probably damaging Het
Bbof1 A G 12: 84,423,449 E33G probably damaging Het
Ccdc149 T C 5: 52,420,772 E106G probably damaging Het
Ceacam5 T A 7: 17,745,635 S226T probably damaging Het
Chd7 G T 4: 8,801,350 S698I possibly damaging Het
Chst2 A G 9: 95,406,095 L66P probably damaging Het
Cps1 C T 1: 67,156,224 P268L probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp3a59 A T 5: 146,099,812 M275L probably benign Het
Ddx41 T G 13: 55,534,300 M232L probably benign Het
Dnah6 C A 6: 73,156,421 A1068S possibly damaging Het
Dnah7a T C 1: 53,582,502 I1155V probably benign Het
Dopey2 G A 16: 93,770,677 V611I probably damaging Het
Epyc A G 10: 97,677,013 Y243C probably damaging Het
Fam171a1 C T 2: 3,225,533 Q568* probably null Het
Gm5930 A G 14: 44,336,461 S105P probably damaging Het
Golga4 A G 9: 118,560,742 D2032G probably benign Het
Gps2 AGTGCT A 11: 69,915,381 probably null Het
H2-DMb1 A G 17: 34,157,315 Y136C probably damaging Het
Il12b A G 11: 44,410,212 E185G probably benign Het
Kat7 A C 11: 95,291,581 I231R probably benign Het
Kcmf1 A T 6: 72,850,483 I58N probably damaging Het
Lmf2 A T 15: 89,351,763 V646E possibly damaging Het
Lmo7 A G 14: 101,888,685 Q409R probably damaging Het
Lmod1 T A 1: 135,364,515 H369Q probably benign Het
Mapk8ip2 G T 15: 89,458,965 V637L probably benign Het
Mettl25 C A 10: 105,763,455 V570L probably benign Het
Mfsd1 T A 3: 67,601,335 N449K probably damaging Het
Olfr1449 T C 19: 12,935,019 S94P possibly damaging Het
Olfr683 A T 7: 105,143,813 M166K probably benign Het
Olfr73 T A 2: 88,035,035 I35F probably damaging Het
Olfr799 G A 10: 129,647,842 C238Y probably benign Het
Pcdhb5 T A 18: 37,322,116 S516R probably benign Het
Plppr3 C T 10: 79,865,360 M549I possibly damaging Het
Ppl A G 16: 5,094,497 V740A probably benign Het
Rabgef1 C T 5: 130,212,087 T349M probably benign Het
Rad51ap2 T C 12: 11,457,108 C344R probably benign Het
Shank2 A G 7: 144,057,718 Q172R possibly damaging Het
Smg9 G A 7: 24,420,121 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Trim42 A T 9: 97,359,240 N646K probably damaging Het
Usp32 T C 11: 85,005,909 I1181V probably benign Het
Vwa5b1 C A 4: 138,591,910 probably null Het
Other mutations in M1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:M1ap APN 6 82956665 missense probably damaging 1.00
IGL01511:M1ap APN 6 83028412 missense probably benign 0.00
IGL01803:M1ap APN 6 83005584 missense probably benign 0.01
IGL02243:M1ap APN 6 83026288 missense probably damaging 1.00
R1799:M1ap UTSW 6 83005510 nonsense probably null
R2073:M1ap UTSW 6 82981882 missense probably benign 0.05
R2074:M1ap UTSW 6 82981882 missense probably benign 0.05
R4063:M1ap UTSW 6 83003775 missense probably damaging 1.00
R5024:M1ap UTSW 6 83028358 unclassified probably benign
R5029:M1ap UTSW 6 83003832 missense probably damaging 1.00
R5564:M1ap UTSW 6 82981817 missense probably damaging 1.00
R5740:M1ap UTSW 6 82981922 missense probably damaging 0.96
R5821:M1ap UTSW 6 82968102 missense probably benign 0.11
R5860:M1ap UTSW 6 83003814 missense probably damaging 1.00
R6190:M1ap UTSW 6 83003896 missense possibly damaging 0.60
R6773:M1ap UTSW 6 82968080 missense probably damaging 1.00
R7350:M1ap UTSW 6 82981949 missense probably benign 0.38
R7736:M1ap UTSW 6 83005584 missense probably benign 0.00
R9684:M1ap UTSW 6 82968113 missense probably benign 0.28
Z1176:M1ap UTSW 6 82968042 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGCCCACATTGAATCC -3'
(R):5'- AGGACACACTCATGCTGGTTC -3'

Sequencing Primer
(F):5'- GTGCCCACATTGAATCCTTTTTAGGG -3'
(R):5'- CTGTACTGTGTATAAGCTGAACAGAG -3'
Posted On 2014-10-30