Incidental Mutation 'R2355:Olfr683'
ID246871
Institutional Source Beutler Lab
Gene Symbol Olfr683
Ensembl Gene ENSMUSG00000044120
Gene Nameolfactory receptor 683
SynonymsGA_x6K02T2PBJ9-7773007-7772066, MOR40-1
MMRRC Submission 040337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2355 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105140839-105147012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105143813 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 166 (M166K)
Ref Sequence ENSEMBL: ENSMUSP00000060527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061284] [ENSMUST00000209879]
Predicted Effect probably benign
Transcript: ENSMUST00000061284
AA Change: M166K

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000060527
Gene: ENSMUSG00000044120
AA Change: M166K

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 8.5e-73 PFAM
Pfam:7TM_GPCR_Srsx 44 315 3.5e-8 PFAM
Pfam:7tm_1 50 300 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209879
AA Change: M160K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211388
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Ahcyl1 A G 3: 107,670,217 S296P probably damaging Het
Alas1 A G 9: 106,236,474 V524A probably damaging Het
Amn C A 12: 111,271,812 D53E probably damaging Het
Bbof1 A G 12: 84,423,449 E33G probably damaging Het
Ccdc149 T C 5: 52,420,772 E106G probably damaging Het
Ceacam5 T A 7: 17,745,635 S226T probably damaging Het
Chd7 G T 4: 8,801,350 S698I possibly damaging Het
Chst2 A G 9: 95,406,095 L66P probably damaging Het
Cps1 C T 1: 67,156,224 P268L probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp3a59 A T 5: 146,099,812 M275L probably benign Het
Ddx41 T G 13: 55,534,300 M232L probably benign Het
Dnah6 C A 6: 73,156,421 A1068S possibly damaging Het
Dnah7a T C 1: 53,582,502 I1155V probably benign Het
Dopey2 G A 16: 93,770,677 V611I probably damaging Het
Epyc A G 10: 97,677,013 Y243C probably damaging Het
Fam171a1 C T 2: 3,225,533 Q568* probably null Het
Gm5930 A G 14: 44,336,461 S105P probably damaging Het
Golga4 A G 9: 118,560,742 D2032G probably benign Het
Gps2 AGTGCT A 11: 69,915,381 probably null Het
H2-DMb1 A G 17: 34,157,315 Y136C probably damaging Het
Il12b A G 11: 44,410,212 E185G probably benign Het
Kat7 A C 11: 95,291,581 I231R probably benign Het
Kcmf1 A T 6: 72,850,483 I58N probably damaging Het
Lmf2 A T 15: 89,351,763 V646E possibly damaging Het
Lmo7 A G 14: 101,888,685 Q409R probably damaging Het
Lmod1 T A 1: 135,364,515 H369Q probably benign Het
M1ap G A 6: 82,956,503 A13T probably benign Het
Mapk8ip2 G T 15: 89,458,965 V637L probably benign Het
Mettl25 C A 10: 105,763,455 V570L probably benign Het
Mfsd1 T A 3: 67,601,335 N449K probably damaging Het
Olfr1449 T C 19: 12,935,019 S94P possibly damaging Het
Olfr73 T A 2: 88,035,035 I35F probably damaging Het
Olfr799 G A 10: 129,647,842 C238Y probably benign Het
Pcdhb5 T A 18: 37,322,116 S516R probably benign Het
Plppr3 C T 10: 79,865,360 M549I possibly damaging Het
Ppl A G 16: 5,094,497 V740A probably benign Het
Rabgef1 C T 5: 130,212,087 T349M probably benign Het
Rad51ap2 T C 12: 11,457,108 C344R probably benign Het
Shank2 A G 7: 144,057,718 Q172R possibly damaging Het
Smg9 G A 7: 24,420,121 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Trim42 A T 9: 97,359,240 N646K probably damaging Het
Usp32 T C 11: 85,005,909 I1181V probably benign Het
Vwa5b1 C A 4: 138,591,910 probably null Het
Other mutations in Olfr683
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr683 APN 7 105143604 missense possibly damaging 0.48
IGL01984:Olfr683 APN 7 105143716 missense probably benign 0.00
IGL02456:Olfr683 APN 7 105143759 missense probably damaging 0.99
IGL03242:Olfr683 APN 7 105144266 missense probably benign 0.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R1282:Olfr683 UTSW 7 105143652 missense probably benign 0.01
R1485:Olfr683 UTSW 7 105143681 missense probably benign 0.00
R1653:Olfr683 UTSW 7 105143870 missense possibly damaging 0.80
R2130:Olfr683 UTSW 7 105143550 missense probably benign 0.03
R4491:Olfr683 UTSW 7 105143776 nonsense probably null
R4826:Olfr683 UTSW 7 105143968 missense probably damaging 0.99
R4980:Olfr683 UTSW 7 105144224 missense probably benign
R5934:Olfr683 UTSW 7 105143660 missense probably benign 0.12
R6354:Olfr683 UTSW 7 105143708 missense probably benign 0.04
R7371:Olfr683 UTSW 7 105143879 missense possibly damaging 0.82
R7463:Olfr683 UTSW 7 105143937 missense probably benign 0.00
R7753:Olfr683 UTSW 7 105143800 missense probably benign 0.07
R8208:Olfr683 UTSW 7 105143418 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCACAGCCTTCAGAATG -3'
(R):5'- AAGGTCCTGGCCATCTTCTG -3'

Sequencing Primer
(F):5'- CACAGCCTTCAGAATGAATGAATAAG -3'
(R):5'- ACAATAAATCTATTGGCTTCTCTTCC -3'
Posted On2014-10-30