Incidental Mutation 'R2355:Olfr1449'
ID246903
Institutional Source Beutler Lab
Gene Symbol Olfr1449
Ensembl Gene ENSMUSG00000049498
Gene Nameolfactory receptor 1449
SynonymsGA_x6K02T2RE5P-3264213-3265157, MOR202-34
MMRRC Submission 040337-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2355 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12930840-12935752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12935019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000148934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056005
AA Change: S94P

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: S94P

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.5e-53 PFAM
Pfam:7tm_1 42 290 3.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208624
AA Change: S94P

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214079
AA Change: S94P

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215325
AA Change: S94P

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Ahcyl1 A G 3: 107,670,217 S296P probably damaging Het
Alas1 A G 9: 106,236,474 V524A probably damaging Het
Amn C A 12: 111,271,812 D53E probably damaging Het
Bbof1 A G 12: 84,423,449 E33G probably damaging Het
Ccdc149 T C 5: 52,420,772 E106G probably damaging Het
Ceacam5 T A 7: 17,745,635 S226T probably damaging Het
Chd7 G T 4: 8,801,350 S698I possibly damaging Het
Chst2 A G 9: 95,406,095 L66P probably damaging Het
Cps1 C T 1: 67,156,224 P268L probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp3a59 A T 5: 146,099,812 M275L probably benign Het
Ddx41 T G 13: 55,534,300 M232L probably benign Het
Dnah6 C A 6: 73,156,421 A1068S possibly damaging Het
Dnah7a T C 1: 53,582,502 I1155V probably benign Het
Dopey2 G A 16: 93,770,677 V611I probably damaging Het
Epyc A G 10: 97,677,013 Y243C probably damaging Het
Fam171a1 C T 2: 3,225,533 Q568* probably null Het
Gm5930 A G 14: 44,336,461 S105P probably damaging Het
Golga4 A G 9: 118,560,742 D2032G probably benign Het
Gps2 AGTGCT A 11: 69,915,381 probably null Het
H2-DMb1 A G 17: 34,157,315 Y136C probably damaging Het
Il12b A G 11: 44,410,212 E185G probably benign Het
Kat7 A C 11: 95,291,581 I231R probably benign Het
Kcmf1 A T 6: 72,850,483 I58N probably damaging Het
Lmf2 A T 15: 89,351,763 V646E possibly damaging Het
Lmo7 A G 14: 101,888,685 Q409R probably damaging Het
Lmod1 T A 1: 135,364,515 H369Q probably benign Het
M1ap G A 6: 82,956,503 A13T probably benign Het
Mapk8ip2 G T 15: 89,458,965 V637L probably benign Het
Mettl25 C A 10: 105,763,455 V570L probably benign Het
Mfsd1 T A 3: 67,601,335 N449K probably damaging Het
Olfr683 A T 7: 105,143,813 M166K probably benign Het
Olfr73 T A 2: 88,035,035 I35F probably damaging Het
Olfr799 G A 10: 129,647,842 C238Y probably benign Het
Pcdhb5 T A 18: 37,322,116 S516R probably benign Het
Plppr3 C T 10: 79,865,360 M549I possibly damaging Het
Ppl A G 16: 5,094,497 V740A probably benign Het
Rabgef1 C T 5: 130,212,087 T349M probably benign Het
Rad51ap2 T C 12: 11,457,108 C344R probably benign Het
Shank2 A G 7: 144,057,718 Q172R possibly damaging Het
Smg9 G A 7: 24,420,121 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Trim42 A T 9: 97,359,240 N646K probably damaging Het
Usp32 T C 11: 85,005,909 I1181V probably benign Het
Vwa5b1 C A 4: 138,591,910 probably null Het
Other mutations in Olfr1449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Olfr1449 APN 19 12935562 missense probably damaging 0.98
IGL01943:Olfr1449 APN 19 12935674 missense probably benign 0.24
IGL02966:Olfr1449 APN 19 12934800 missense probably benign 0.08
IGL02974:Olfr1449 APN 19 12935035 missense probably benign 0.02
IGL03220:Olfr1449 APN 19 12935494 missense probably damaging 1.00
PIT4531001:Olfr1449 UTSW 19 12935277 missense probably damaging 0.98
R0285:Olfr1449 UTSW 19 12935172 missense probably benign 0.00
R0573:Olfr1449 UTSW 19 12935260 missense possibly damaging 0.77
R0588:Olfr1449 UTSW 19 12934747 missense probably benign 0.00
R0726:Olfr1449 UTSW 19 12935605 missense probably damaging 1.00
R1006:Olfr1449 UTSW 19 12935274 missense probably damaging 1.00
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1386:Olfr1449 UTSW 19 12935139 missense probably benign 0.17
R1735:Olfr1449 UTSW 19 12934843 missense probably damaging 1.00
R1794:Olfr1449 UTSW 19 12934968 missense probably damaging 0.97
R2511:Olfr1449 UTSW 19 12935173 missense possibly damaging 0.85
R4673:Olfr1449 UTSW 19 12935097 missense probably damaging 1.00
R4749:Olfr1449 UTSW 19 12935217 missense probably benign 0.02
R4765:Olfr1449 UTSW 19 12935076 missense possibly damaging 0.65
R5112:Olfr1449 UTSW 19 12934816 missense probably benign 0.01
R5958:Olfr1449 UTSW 19 12935047 missense probably damaging 1.00
R6115:Olfr1449 UTSW 19 12935584 missense possibly damaging 0.54
R6152:Olfr1449 UTSW 19 12935487 missense probably benign 0.13
R6417:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6420:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6695:Olfr1449 UTSW 19 12935400 missense possibly damaging 0.95
R6963:Olfr1449 UTSW 19 12935638 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTGACTGATATCCCAGAGCTG -3'
(R):5'- TAACAGGCAATCACCATGCG -3'

Sequencing Primer
(F):5'- TGATATCCCAGAGCTGCAAGTC -3'
(R):5'- TGCGAGCACACACACTGGTAG -3'
Posted On2014-10-30