Incidental Mutation 'R2356:Prss40'
ID246906
Institutional Source Beutler Lab
Gene Symbol Prss40
Ensembl Gene ENSMUSG00000037529
Gene Nameprotease, serine 40
SynonymsTesp2
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location34543968-34560943 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34559903 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 69 (Y69*)
Ref Sequence ENSEMBL: ENSMUSP00000110723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047840] [ENSMUST00000115071] [ENSMUST00000190790]
Predicted Effect probably damaging
Transcript: ENSMUST00000047840
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045118
Gene: ENSMUSG00000037529
AA Change: C60S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Tryp_SPc 68 308 1.45e-71 SMART
low complexity region 309 319 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115071
AA Change: Y69*
SMART Domains Protein: ENSMUSP00000110723
Gene: ENSMUSG00000037529
AA Change: Y69*

DomainStartEndE-ValueType
Tryp_SPc 1 146 8.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190790
SMART Domains Protein: ENSMUSP00000140885
Gene: ENSMUSG00000037529

DomainStartEndE-ValueType
Tryp_SPc 4 145 2.3e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Prss40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Prss40 APN 1 34552539 missense probably benign 0.01
IGL01298:Prss40 APN 1 34560766 missense probably benign
IGL01694:Prss40 APN 1 34556097 missense probably benign 0.02
IGL03030:Prss40 APN 1 34558101 missense probably damaging 0.99
IGL03393:Prss40 APN 1 34558101 missense probably damaging 0.99
R0294:Prss40 UTSW 1 34556081 missense possibly damaging 0.58
R1450:Prss40 UTSW 1 34556097 missense probably benign 0.02
R1987:Prss40 UTSW 1 34558014 missense possibly damaging 0.75
R2395:Prss40 UTSW 1 34559905 missense possibly damaging 0.86
R4042:Prss40 UTSW 1 34560879 nonsense probably null
R4043:Prss40 UTSW 1 34560879 nonsense probably null
R4044:Prss40 UTSW 1 34560879 nonsense probably null
R4232:Prss40 UTSW 1 34560792 missense probably benign 0.07
R5418:Prss40 UTSW 1 34560759 missense probably benign 0.00
R5539:Prss40 UTSW 1 34552679 makesense probably null
R5719:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R6365:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R7002:Prss40 UTSW 1 34552400 utr 3 prime probably null
R7366:Prss40 UTSW 1 34559871 nonsense probably null
R7521:Prss40 UTSW 1 34558009 missense probably benign 0.03
R7777:Prss40 UTSW 1 34552765 nonsense probably null
R8138:Prss40 UTSW 1 34557999 missense probably damaging 0.99
Z1176:Prss40 UTSW 1 34559779 missense possibly damaging 0.85
Z1177:Prss40 UTSW 1 34552586 missense probably benign 0.00
Z1177:Prss40 UTSW 1 34560819 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAACACGCACCTTTGGAAG -3'
(R):5'- TTGTGAGCCTTGCTGAGAGC -3'

Sequencing Primer
(F):5'- ACGCACCTTTGGAAGCAGTG -3'
(R):5'- AGCAAGCCTTGGTCTGATC -3'
Posted On2014-10-30