Incidental Mutation 'R2356:Erbb4'

• ID: 246907
• Institutional Source: Beutler Lab
• Gene Symbol: Erbb4
• Ensembl Gene: ENSMUSG00000062209
• Gene Name: erb-b2 receptor tyrosine kinase 4
• Synonyms: Her4, ErbB4
• MMRRC Submission: 040338-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R2356 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 1
• Chromosomal Location: 68032186-69108059 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to A at 68078596 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Methionine to Leucine at position 887 (M887L)
• Ref Sequence: ENSEMBL: ENSMUSP00000114123
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
• AlphaFold: Q61527
• Predicted Effect: probably benign; Transcript: ENSMUST00000119142; AA Change: M887L; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
• SMART Domains: Protein: ENSMUSP00000112713; Gene: ENSMUSG00000062209; AA Change: M887L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	5e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	1e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000121473; AA Change: M887L; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
• SMART Domains: Protein: ENSMUSP00000114123; Gene: ENSMUSG00000062209; AA Change: M887L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.6e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.5e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

• Coding Region Coverage:
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
• MGI Phenotype: Strain: 1929607; Lethality: E10-E11; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
• Allele List at MGI:

  All alleles(7) : Targeted(6) Gene trapped(1)

• Posted On: 2014-10-30

Predicted Primers

PCR Primer
(F):5'- GAGACCAGAGAGTTAATTACTTTAGGG -3'
(R):5'- ATAATGCCAGGCTTAACGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACAGATGGCTTCC -3'
(R):5'- GGCTTAACGTCAGGTCAAAATTTAG -3'