Incidental Mutation 'R2356:Erbb4'
ID246907
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 040338-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68078596 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 887 (M887L)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: M887L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: M887L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
AA Change: M887L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: M887L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAGACCAGAGAGTTAATTACTTTAGGG -3'
(R):5'- ATAATGCCAGGCTTAACGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACAGATGGCTTCC -3'
(R):5'- GGCTTAACGTCAGGTCAAAATTTAG -3'
Posted On2014-10-30