Incidental Mutation 'R2356:Cxcr4'
ID246908
Institutional Source Beutler Lab
Gene Symbol Cxcr4
Ensembl Gene ENSMUSG00000045382
Gene Namechemokine (C-X-C motif) receptor 4
Synonymsfusin, Cmkar4, CD184, Sdf1r, b2b220Clo, PB-CKR
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128588199-128592293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128589514 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 135 (Y135H)
Ref Sequence ENSEMBL: ENSMUSP00000120153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052172] [ENSMUST00000142893]
Predicted Effect probably damaging
Transcript: ENSMUST00000052172
AA Change: Y137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053489
Gene: ENSMUSG00000045382
AA Change: Y137H

DomainStartEndE-ValueType
Pfam:CXCR4_N 8 40 2.1e-18 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.5e-7 PFAM
Pfam:7tm_1 57 309 2.4e-52 PFAM
low complexity region 344 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142893
AA Change: Y135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120153
Gene: ENSMUSG00000045382
AA Change: Y135H

DomainStartEndE-ValueType
Pfam:CXCR4_N 6 38 1.5e-24 PFAM
Pfam:7TM_GPCR_Srsx 49 270 2.4e-8 PFAM
Pfam:7tm_1 55 272 1.9e-51 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants exhibit altered viability, lungs, kidneys, immune system, hematopoiesis, myelopoiesis, cerebellar foliation, neuronal cell layer development, susceptibility to diet-induced obesity and adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Cxcr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Cxcr4 APN 1 128589055 missense probably damaging 1.00
IGL01343:Cxcr4 APN 1 128589555 missense probably damaging 1.00
IGL03202:Cxcr4 APN 1 128588904 missense probably damaging 1.00
Rubber_ducky UTSW 1 128589450 missense probably damaging 1.00
R1728:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1729:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1730:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1739:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1762:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1783:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1784:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1785:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R5199:Cxcr4 UTSW 1 128589546 missense probably damaging 1.00
R5472:Cxcr4 UTSW 1 128589625 missense probably damaging 1.00
R5969:Cxcr4 UTSW 1 128589847 missense probably benign
R6124:Cxcr4 UTSW 1 128589660 missense probably damaging 1.00
R6211:Cxcr4 UTSW 1 128589450 missense probably damaging 1.00
R6228:Cxcr4 UTSW 1 128592183 splice site probably null
R6349:Cxcr4 UTSW 1 128589277 missense possibly damaging 0.78
R6458:Cxcr4 UTSW 1 128589094 missense probably benign 0.05
R6949:Cxcr4 UTSW 1 128589615 missense probably benign
R7230:Cxcr4 UTSW 1 128589790 missense probably damaging 0.98
R7715:Cxcr4 UTSW 1 128589742 missense probably damaging 1.00
R8040:Cxcr4 UTSW 1 128589798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTCACAGATGTACCTGTC -3'
(R):5'- GATCCTGGTCATGGGTTACC -3'

Sequencing Primer
(F):5'- GGTCACAGATGTACCTGTCATCCC -3'
(R):5'- CATGACGGACAAGTACCGGC -3'
Posted On2014-10-30