Incidental Mutation 'R2356:Itga8'
ID 246910
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 040338-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R2356 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12204952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 495 (H495R)
Ref Sequence ENSEMBL: ENSMUSP00000134154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably benign
Transcript: ENSMUST00000028106
AA Change: H495R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: H495R

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
AA Change: H495R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: H495R

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G T 16: 20,379,249 (GRCm39) R705L probably benign Het
Adcy6 A T 15: 98,494,897 (GRCm39) probably null Het
Ank1 A T 8: 23,575,688 (GRCm39) T145S probably damaging Het
Aph1a T C 3: 95,801,544 (GRCm39) F21S probably benign Het
Apoa5 T A 9: 46,181,341 (GRCm39) V139E probably damaging Het
Arhgap44 T C 11: 64,900,851 (GRCm39) K595R probably damaging Het
Arhgap5 C T 12: 52,565,930 (GRCm39) P967L probably benign Het
Atp13a5 A T 16: 29,099,887 (GRCm39) I683N probably damaging Het
Cdc6 A G 11: 98,810,118 (GRCm39) T476A probably benign Het
Cdk10 T C 8: 123,955,908 (GRCm39) V199A probably damaging Het
Ces2h G A 8: 105,742,570 (GRCm39) C94Y probably damaging Het
Clcn1 G A 6: 42,268,559 (GRCm39) G155D probably damaging Het
Cxcr4 A G 1: 128,517,251 (GRCm39) Y135H probably damaging Het
Dapp1 A G 3: 137,643,510 (GRCm39) V184A possibly damaging Het
Dhrs7 A C 12: 72,699,155 (GRCm39) S276A probably benign Het
Dlg5 A G 14: 24,220,496 (GRCm39) probably null Het
Dnaaf1 T A 8: 120,315,026 (GRCm39) F278Y probably damaging Het
Dnaaf2 A G 12: 69,244,992 (GRCm39) F23S probably benign Het
En2 G T 5: 28,371,330 (GRCm39) probably benign Het
Erbb4 T A 1: 68,117,755 (GRCm39) M887L probably benign Het
Exoc5 T C 14: 49,253,738 (GRCm39) M482V probably benign Het
Foxk1 A G 5: 142,441,164 (GRCm39) I571V possibly damaging Het
Fry G A 5: 150,394,897 (GRCm39) G650D probably benign Het
Gm8225 T C 17: 26,762,378 (GRCm39) S190P probably damaging Het
Gpx5 G C 13: 21,475,538 (GRCm39) H63D possibly damaging Het
Ipo9 A T 1: 135,334,555 (GRCm39) S285T probably benign Het
Klf11 T C 12: 24,703,582 (GRCm39) S6P probably damaging Het
Krtap8-1 A T 16: 89,284,789 (GRCm39) Y3N possibly damaging Het
Krtap8-1 G T 16: 89,284,790 (GRCm39) Y2* probably null Het
Lama1 T A 17: 68,117,109 (GRCm39) L2468Q probably damaging Het
Lmo7 T C 14: 102,124,381 (GRCm39) L280S probably damaging Het
Matk G A 10: 81,097,377 (GRCm39) probably null Het
Mcmdc2 A G 1: 10,001,026 (GRCm39) T434A possibly damaging Het
Mst1r T A 9: 107,795,069 (GRCm39) L1283Q probably damaging Het
Muc21 A G 17: 35,932,563 (GRCm39) probably benign Het
Nbn T A 4: 15,970,863 (GRCm39) I282N probably damaging Het
Ncln A G 10: 81,328,756 (GRCm39) V174A probably benign Het
Nipa2 G A 7: 55,582,714 (GRCm39) H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 (GRCm38) noncoding transcript Het
Or56b1 G T 7: 104,285,834 (GRCm39) E318* probably null Het
Or6c38 T C 10: 128,929,761 (GRCm39) I27M probably benign Het
Pik3r5 T C 11: 68,383,743 (GRCm39) S521P probably damaging Het
Pkhd1l1 C T 15: 44,396,415 (GRCm39) T1979M probably benign Het
Plekhn1 T G 4: 156,307,158 (GRCm39) D464A probably damaging Het
Ppp4r1 T A 17: 66,140,045 (GRCm39) Y648N probably damaging Het
Prkaa2 C T 4: 104,896,918 (GRCm39) probably null Het
Prkdc T A 16: 15,502,068 (GRCm39) H828Q probably benign Het
Prss40 A T 1: 34,598,984 (GRCm39) Y69* probably null Het
Prx C T 7: 27,207,284 (GRCm39) probably benign Het
Psmd11 T A 11: 80,319,530 (GRCm39) S7T possibly damaging Het
Psmd14 A T 2: 61,630,351 (GRCm39) H287L probably benign Het
Rcor1 T C 12: 111,076,226 (GRCm39) Y297H probably damaging Het
Rnf40 T G 7: 127,190,748 (GRCm39) V272G probably damaging Het
Serpina3f G T 12: 104,183,626 (GRCm39) E163* probably null Het
Setd4 G A 16: 93,387,871 (GRCm39) T205I probably damaging Het
Shroom1 A T 11: 53,357,274 (GRCm39) T646S probably benign Het
Smg8 G C 11: 86,976,554 (GRCm39) S342R probably benign Het
Spata31h1 A G 10: 82,119,789 (GRCm39) V4407A possibly damaging Het
Trhde T C 10: 114,237,421 (GRCm39) Y986C probably damaging Het
Tulp2 A T 7: 45,168,052 (GRCm39) T155S possibly damaging Het
Vmn1r212 A T 13: 23,068,120 (GRCm39) L71* probably null Het
Wnk2 A T 13: 49,192,644 (GRCm39) C2032* probably null Het
Zfp429 A G 13: 67,538,746 (GRCm39) Y233H probably benign Het
Zfp809 C A 9: 22,154,336 (GRCm39) T351K probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTCCTCTGGTAACACAGAC -3'
(R):5'- AGCAGGGTTCATTGTGCAAGG -3'

Sequencing Primer
(F):5'- TCTAGATCCACAGTGTGCATGAC -3'
(R):5'- CATTGTGCAAGGCTGGGC -3'
Posted On 2014-10-30