Mutagenetix > Incidental Mutation

Incidental Mutation 'R2356:Itga8'

246910

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

040338-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R2356 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12200141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 495 (H495R)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: H495R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: H495R

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791
AA Change: H495R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: H495R

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,283,955	V4407A	possibly damaging	Het
Abcf3	G	T	16: 20,560,499	R705L	probably benign	Het
Adcy6	A	T	15: 98,597,016		probably null	Het
Ank1	A	T	8: 23,085,672	T145S	probably damaging	Het
Aph1a	T	C	3: 95,894,232	F21S	probably benign	Het
Apoa5	T	A	9: 46,270,043	V139E	probably damaging	Het
Arhgap44	T	C	11: 65,010,025	K595R	probably damaging	Het
Arhgap5	C	T	12: 52,519,147	P967L	probably benign	Het
Atp13a5	A	T	16: 29,281,069	I683N	probably damaging	Het
Cdc6	A	G	11: 98,919,292	T476A	probably benign	Het
Cdk10	T	C	8: 123,229,169	V199A	probably damaging	Het
Ces2h	G	A	8: 105,015,938	C94Y	probably damaging	Het
Clcn1	G	A	6: 42,291,625	G155D	probably damaging	Het
Cxcr4	A	G	1: 128,589,514	Y135H	probably damaging	Het
Dapp1	A	G	3: 137,937,749	V184A	possibly damaging	Het
Dhrs7	A	C	12: 72,652,381	S276A	probably benign	Het
Dlg5	A	G	14: 24,170,428		probably null	Het
Dnaaf1	T	A	8: 119,588,287	F278Y	probably damaging	Het
Dnaaf2	A	G	12: 69,198,218	F23S	probably benign	Het
En2	G	T	5: 28,166,332		probably benign	Het
Erbb4	T	A	1: 68,078,596	M887L	probably benign	Het
Exoc5	T	C	14: 49,016,281	M482V	probably benign	Het
Foxk1	A	G	5: 142,455,409	I571V	possibly damaging	Het
Fry	G	A	5: 150,471,432	G650D	probably benign	Het
Gm8225	T	C	17: 26,543,404	S190P	probably damaging	Het
Gm9573	A	G	17: 35,621,671		probably benign	Het
Gpx5	G	C	13: 21,291,368	H63D	possibly damaging	Het
Ipo9	A	T	1: 135,406,817	S285T	probably benign	Het
Klf11	T	C	12: 24,653,583	S6P	probably damaging	Het
Krtap8-1	A	T	16: 89,487,901	Y3N	possibly damaging	Het
Krtap8-1	G	T	16: 89,487,902	Y2*	probably null	Het
Lama1	T	A	17: 67,810,114	L2468Q	probably damaging	Het
Lmo7	T	C	14: 101,886,945	L280S	probably damaging	Het
Matk	G	A	10: 81,261,543		probably null	Het
Mcmdc2	A	G	1: 9,930,801	T434A	possibly damaging	Het
Mst1r	T	A	9: 107,917,870	L1283Q	probably damaging	Het
Nbn	T	A	4: 15,970,863	I282N	probably damaging	Het
Ncln	A	G	10: 81,492,922	V174A	probably benign	Het
Nipa2	G	A	7: 55,932,966	H344Y	probably benign	Het
Nlrp4g	A	G	9: 124,349,306		noncoding transcript	Het
Olfr657	G	T	7: 104,636,627	E318*	probably null	Het
Olfr768	T	C	10: 129,093,892	I27M	probably benign	Het
Pik3r5	T	C	11: 68,492,917	S521P	probably damaging	Het
Pkhd1l1	C	T	15: 44,533,019	T1979M	probably benign	Het
Plekhn1	T	G	4: 156,222,701	D464A	probably damaging	Het
Ppp4r1	T	A	17: 65,833,050	Y648N	probably damaging	Het
Prkaa2	C	T	4: 105,039,721		probably null	Het
Prkdc	T	A	16: 15,684,204	H828Q	probably benign	Het
Prss40	A	T	1: 34,559,903	Y69*	probably null	Het
Prx	C	T	7: 27,507,859		probably benign	Het
Psmd11	T	A	11: 80,428,704	S7T	possibly damaging	Het
Psmd14	A	T	2: 61,800,007	H287L	probably benign	Het
Rcor1	T	C	12: 111,109,792	Y297H	probably damaging	Het
Rnf40	T	G	7: 127,591,576	V272G	probably damaging	Het
Serpina3f	G	T	12: 104,217,367	E163*	probably null	Het
Setd4	G	A	16: 93,590,983	T205I	probably damaging	Het
Shroom1	A	T	11: 53,466,447	T646S	probably benign	Het
Smg8	G	C	11: 87,085,728	S342R	probably benign	Het
Trhde	T	C	10: 114,401,516	Y986C	probably damaging	Het
Tulp2	A	T	7: 45,518,628	T155S	possibly damaging	Het
Vmn1r212	A	T	13: 22,883,950	L71*	probably null	Het
Wnk2	A	T	13: 49,039,168	C2032*	probably null	Het
Zfp429	A	G	13: 67,390,627	Y233H	probably benign	Het
Zfp809	C	A	9: 22,243,040	T351K	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCTCCTCTGGTAACACAGAC -3'
(R):5'- AGCAGGGTTCATTGTGCAAGG -3'

Sequencing Primer
(F):5'- TCTAGATCCACAGTGTGCATGAC -3'
(R):5'- CATTGTGCAAGGCTGGGC -3'

Posted On

2014-10-30