Incidental Mutation 'R2356:Aph1a'
ID246914
Institutional Source Beutler Lab
Gene Symbol Aph1a
Ensembl Gene ENSMUSG00000015750
Gene Nameaph1 homolog A, gamma secretase subunit
Synonyms6530402N02Rik
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2356 (G1)
Quality Score164
Status Not validated
Chromosome3
Chromosomal Location95893969-95898288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95894232 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 21 (F21S)
Ref Sequence ENSEMBL: ENSMUSP00000142972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000036360] [ENSMUST00000056710] [ENSMUST00000090476] [ENSMUST00000171519] [ENSMUST00000197081]
Predicted Effect probably benign
Transcript: ENSMUST00000015894
AA Change: F21S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750
AA Change: F21S

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036181
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056710
AA Change: F21S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750
AA Change: F21S

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145949
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197081
AA Change: F21S

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the gamma-secretase complex, which is localized to the endoplasmic reticulum and golgi apparatus. Gamma-secretase is a multi-protein enzyme that catalyzes intramembraneous proteolysis of type I transmembrane proteins and is essential for many signaling pathways, including the Notch signaling pathway. Studies suggest that the protein encoded by this locus binds directly to substrates of the gamma-secretase complex, including the beta-amyloid precursor protein which is associated with Alzheimer disease progression. This gene is required for normal embryonic development and survival, and disruption is associated with defects in the yolk sack angiogenesis, neural tube formation, and somitogenesis. A pseudogene of this gene is located on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null embryos die by E11, are severely growth retarded by E9.5 and display defects in somite patterning, branchial arch and heart chamber development, vascular morphogenesis of the yolk sac and have distended pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Aph1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Aph1a APN 3 95895813 missense probably damaging 0.99
R1675:Aph1a UTSW 3 95894899 missense possibly damaging 0.96
R1735:Aph1a UTSW 3 95895509 missense probably damaging 1.00
R1872:Aph1a UTSW 3 95895564 missense probably damaging 1.00
R3942:Aph1a UTSW 3 95894261 missense probably damaging 1.00
R4654:Aph1a UTSW 3 95895776 missense probably benign 0.01
R4989:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5134:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5184:Aph1a UTSW 3 95895739 unclassified probably null
R6603:Aph1a UTSW 3 95895496 missense probably damaging 1.00
R6650:Aph1a UTSW 3 95896286 missense probably benign 0.28
R8157:Aph1a UTSW 3 95894838 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TATTCATTGGCCTTCCGGGG -3'
(R):5'- ATTTGACCCTGTGTCCAACC -3'

Sequencing Primer
(F):5'- TTCCGTAGACGAGGTCGG -3'
(R):5'- TGTGTCCAACCTTTTCCGAC -3'
Posted On2014-10-30