Incidental Mutation 'R2356:Cdk10'
ID246936
Institutional Source Beutler Lab
Gene Symbol Cdk10
Ensembl Gene ENSMUSG00000033862
Gene Namecyclin-dependent kinase 10
Synonyms
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123224842-123232250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123229169 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 199 (V199A)
Ref Sequence ENSEMBL: ENSMUSP00000045527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036880] [ENSMUST00000098327] [ENSMUST00000127664] [ENSMUST00000166768] [ENSMUST00000212193] [ENSMUST00000212361] [ENSMUST00000213005]
Predicted Effect probably damaging
Transcript: ENSMUST00000036880
AA Change: V199A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045527
Gene: ENSMUSG00000033862
AA Change: V199A

DomainStartEndE-ValueType
S_TKc 39 323 1.52e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098327
SMART Domains Protein: ENSMUSP00000095932
Gene: ENSMUSG00000033594

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 209 214 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 309 318 N/A INTRINSIC
low complexity region 340 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166768
SMART Domains Protein: ENSMUSP00000130306
Gene: ENSMUSG00000033594

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 209 214 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 309 318 N/A INTRINSIC
low complexity region 340 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212021
Predicted Effect probably benign
Transcript: ENSMUST00000212028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212035
Predicted Effect probably benign
Transcript: ENSMUST00000212193
Predicted Effect probably benign
Transcript: ENSMUST00000212361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212784
Predicted Effect probably damaging
Transcript: ENSMUST00000213005
AA Change: V128A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212904
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the CDK (cyclin-dependent kinase) subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. The human ortholog has been shown to play a role in cellular proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 1. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Cdk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cdk10 APN 8 123230324 missense possibly damaging 0.78
IGL01613:Cdk10 APN 8 123228387 missense probably damaging 0.99
IGL01682:Cdk10 APN 8 123227658 critical splice acceptor site probably null
IGL02536:Cdk10 APN 8 123227015 missense possibly damaging 0.64
R0612:Cdk10 UTSW 8 123230680 missense probably benign 0.16
R1159:Cdk10 UTSW 8 123228323 splice site probably benign
R4838:Cdk10 UTSW 8 123230614 missense probably damaging 1.00
R5453:Cdk10 UTSW 8 123226392 missense probably benign 0.42
R5517:Cdk10 UTSW 8 123230587 splice site probably null
R5804:Cdk10 UTSW 8 123228840 splice site probably null
R6930:Cdk10 UTSW 8 123230608 missense probably damaging 1.00
R6971:Cdk10 UTSW 8 123227674 missense probably damaging 1.00
R7910:Cdk10 UTSW 8 123226366 missense probably damaging 1.00
R8356:Cdk10 UTSW 8 123228357 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCTGACCCTGCATATGTG -3'
(R):5'- GCAGTTTTGAGGCCACTGAG -3'

Sequencing Primer
(F):5'- AACCAGAGATGACTTGTCTGTTTCC -3'
(R):5'- TTTTGAGGCCACTGAGCCTAGC -3'
Posted On2014-10-30