Incidental Mutation 'R2356:Apoa5'
ID 246938
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Name apolipoprotein A-V
Synonyms 1300007O05Rik, RAP3, Apoav
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2356 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 46268633-46271919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46270043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 139 (V139E)
Ref Sequence ENSEMBL: ENSMUSP00000113413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
AlphaFold Q8C7G5
Predicted Effect probably damaging
Transcript: ENSMUST00000034584
AA Change: V139E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: V139E

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121598
AA Change: V139E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: V139E

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215484
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46270652 missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46269139 critical splice donor site probably null
R0046:Apoa5 UTSW 9 46269998 missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46270549 nonsense probably null
R2007:Apoa5 UTSW 9 46270367 missense possibly damaging 0.95
R3739:Apoa5 UTSW 9 46269117 missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46270580 missense probably damaging 1.00
R4364:Apoa5 UTSW 9 46270529 missense probably damaging 1.00
R4657:Apoa5 UTSW 9 46269872 missense probably benign 0.12
R4760:Apoa5 UTSW 9 46270295 missense probably damaging 0.97
R5160:Apoa5 UTSW 9 46270496 missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46270589 missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46269309 missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46270633 nonsense probably null
R6849:Apoa5 UTSW 9 46270000 missense probably benign 0.03
R7170:Apoa5 UTSW 9 46270139 missense probably benign 0.00
R9268:Apoa5 UTSW 9 46270421 missense probably benign 0.18
R9403:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
R9495:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
R9499:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
Z1177:Apoa5 UTSW 9 46269119 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TAGAAAAGCTGGGACCCTTG -3'
(R):5'- ATTCCAGTCACCAAGCGTTC -3'

Sequencing Primer
(F):5'- AGCTGGGACCCTTGAGAGG -3'
(R):5'- TTCTGCGTAAGGGTGGAAGAGC -3'
Posted On 2014-10-30