Incidental Mutation 'R2356:Gpx5'
ID246961
Institutional Source Beutler Lab
Gene Symbol Gpx5
Ensembl Gene ENSMUSG00000004344
Gene Nameglutathione peroxidase 5
SynonymsArep
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21286429-21292731 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 21291368 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 63 (H63D)
Ref Sequence ENSEMBL: ENSMUSP00000106117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004456
AA Change: H63D

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004456
Gene: ENSMUSG00000004344
AA Change: H63D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:GSHPx 40 153 8e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110491
AA Change: H63D

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106117
Gene: ENSMUSG00000004344
AA Change: H63D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:GSHPx 56 169 3.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117685
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the glutathione peroxidase family. It is specifically expressed in the epididymis in the mammalian male reproductive tract, and is androgen-regulated. Unlike several other characterized glutathione peroxidases, this enzyme is not a selenoprotein, lacking the selenocysteine residue. Thus, it is selenium-independent, and has been proposed to play a role in protecting the membranes of spermatozoa from the damaging effects of lipid peroxidation and/or preventing premature acrosome reaction. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit age-dependent reduced fertility due to increased sensitivity of sperm DNA to oxidative attack. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Gpx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Gpx5 APN 13 21287499 missense probably damaging 1.00
R0233:Gpx5 UTSW 13 21287403 missense probably damaging 1.00
R0233:Gpx5 UTSW 13 21287403 missense probably damaging 1.00
R1836:Gpx5 UTSW 13 21287454 missense probably benign
R2495:Gpx5 UTSW 13 21291440 missense probably benign 0.24
R5023:Gpx5 UTSW 13 21288745 missense probably damaging 0.97
R5078:Gpx5 UTSW 13 21288711 missense probably damaging 1.00
R5479:Gpx5 UTSW 13 21292635 missense probably benign
R6166:Gpx5 UTSW 13 21289265 missense probably damaging 1.00
R6370:Gpx5 UTSW 13 21288702 critical splice donor site probably null
R6989:Gpx5 UTSW 13 21287499 missense probably damaging 1.00
R7017:Gpx5 UTSW 13 21291391 missense probably damaging 1.00
R7891:Gpx5 UTSW 13 21288748 missense probably damaging 1.00
R7974:Gpx5 UTSW 13 21288748 missense probably damaging 1.00
R8155:Gpx5 UTSW 13 21288747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGTGGGCCATTCTTTGC -3'
(R):5'- AGTCCTGGTTACCACCTTCG -3'

Sequencing Primer
(F):5'- GGCCATTCTTTGCTGATTTAAGAC -3'
(R):5'- CGCTGTCCACATGTGCTTTGG -3'
Posted On2014-10-30