Incidental Mutation 'R2356:Lmo7'
ID246969
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101886945 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 280 (L280S)
Ref Sequence ENSEMBL: ENSMUSP00000123706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100337
AA Change: L402S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: L402S

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159026
AA Change: L169S

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: L169S

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159258
AA Change: L169S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: L169S

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159314
AA Change: L169S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: L169S

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159597
AA Change: L280S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: L280S

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159797
Predicted Effect probably benign
Transcript: ENSMUST00000159806
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162091
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
R7337:Lmo7 UTSW 14 101884204 missense probably damaging 0.98
R7341:Lmo7 UTSW 14 101885512 missense probably benign 0.30
R7408:Lmo7 UTSW 14 101880953 missense probably damaging 1.00
R7432:Lmo7 UTSW 14 101902115 missense probably benign 0.42
R7470:Lmo7 UTSW 14 101900604 missense possibly damaging 0.83
R7506:Lmo7 UTSW 14 101919609 missense unknown
R7559:Lmo7 UTSW 14 101887226 nonsense probably null
R7565:Lmo7 UTSW 14 101885301 missense probably damaging 0.98
R7788:Lmo7 UTSW 14 101898576 missense possibly damaging 0.64
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGGAAAGTCAGAGACTAGTTTTG -3'
(R):5'- GATTTGCATGGAAAGCCCCTG -3'

Sequencing Primer
(F):5'- AAACCCCGATGACTACTG -3'
(R):5'- GAAAGCCCCTGTTTTTCTGACAAAG -3'
Posted On2014-10-30