Incidental Mutation 'R2356:Adcy6'
ID246971
Institutional Source Beutler Lab
Gene Symbol Adcy6
Ensembl Gene ENSMUSG00000022994
Gene Nameadenylate cyclase 6
Synonyms
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98589973-98610076 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 98597016 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096224] [ENSMUST00000096224] [ENSMUST00000228566] [ENSMUST00000228566] [ENSMUST00000228903]
Predicted Effect probably null
Transcript: ENSMUST00000096224
SMART Domains Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994

DomainStartEndE-ValueType
low complexity region 150 166 N/A INTRINSIC
low complexity region 169 177 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
CYCc 331 532 2.95e-63 SMART
Pfam:DUF1053 580 669 3.5e-18 PFAM
transmembrane domain 701 723 N/A INTRINSIC
transmembrane domain 744 763 N/A INTRINSIC
transmembrane domain 815 834 N/A INTRINSIC
transmembrane domain 839 861 N/A INTRINSIC
Blast:CYCc 885 929 5e-20 BLAST
CYCc 939 1147 4.81e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096224
SMART Domains Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994

DomainStartEndE-ValueType
low complexity region 150 166 N/A INTRINSIC
low complexity region 169 177 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
CYCc 331 532 2.95e-63 SMART
Pfam:DUF1053 580 669 3.5e-18 PFAM
transmembrane domain 701 723 N/A INTRINSIC
transmembrane domain 744 763 N/A INTRINSIC
transmembrane domain 815 834 N/A INTRINSIC
transmembrane domain 839 861 N/A INTRINSIC
Blast:CYCc 885 929 5e-20 BLAST
CYCc 939 1147 4.81e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226236
Predicted Effect probably null
Transcript: ENSMUST00000228566
Predicted Effect probably null
Transcript: ENSMUST00000228566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228596
Predicted Effect probably benign
Transcript: ENSMUST00000228903
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Nbn T A 4: 15,970,863 I282N probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Adcy6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Adcy6 APN 15 98598976 missense probably damaging 1.00
IGL01132:Adcy6 APN 15 98597851 missense probably benign 0.14
IGL01642:Adcy6 APN 15 98594509 missense possibly damaging 0.88
IGL01647:Adcy6 APN 15 98600275 missense probably damaging 1.00
IGL01788:Adcy6 APN 15 98596519 nonsense probably null
IGL02122:Adcy6 APN 15 98598882 missense possibly damaging 0.66
IGL02210:Adcy6 APN 15 98594971 missense possibly damaging 0.63
IGL02249:Adcy6 APN 15 98599914 missense probably damaging 1.00
IGL02404:Adcy6 APN 15 98596938 missense probably benign
IGL02691:Adcy6 APN 15 98604304 missense probably damaging 1.00
PIT4515001:Adcy6 UTSW 15 98595146 missense probably benign 0.04
R0178:Adcy6 UTSW 15 98604215 missense probably benign 0.00
R0497:Adcy6 UTSW 15 98597725 critical splice donor site probably null
R0739:Adcy6 UTSW 15 98598379 missense probably benign 0.00
R1454:Adcy6 UTSW 15 98604728 missense probably damaging 1.00
R1473:Adcy6 UTSW 15 98592743 missense probably damaging 0.99
R1536:Adcy6 UTSW 15 98600007 missense probably damaging 1.00
R1927:Adcy6 UTSW 15 98598498 splice site probably null
R2178:Adcy6 UTSW 15 98594355 missense probably damaging 1.00
R2294:Adcy6 UTSW 15 98597441 missense possibly damaging 0.48
R2898:Adcy6 UTSW 15 98593488 missense probably damaging 1.00
R3001:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3002:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3794:Adcy6 UTSW 15 98598943 missense probably damaging 1.00
R3884:Adcy6 UTSW 15 98597174 missense probably benign 0.06
R4348:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4351:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4542:Adcy6 UTSW 15 98598988 missense possibly damaging 0.70
R4548:Adcy6 UTSW 15 98598659 missense probably damaging 1.00
R5693:Adcy6 UTSW 15 98603989 missense probably damaging 1.00
R5707:Adcy6 UTSW 15 98598741 missense probably damaging 1.00
R5994:Adcy6 UTSW 15 98593664 missense probably damaging 1.00
R5998:Adcy6 UTSW 15 98594354 nonsense probably null
R6142:Adcy6 UTSW 15 98598422 missense probably benign
R6242:Adcy6 UTSW 15 98604015 nonsense probably null
R6305:Adcy6 UTSW 15 98598645 missense probably benign 0.13
R6751:Adcy6 UTSW 15 98596205 missense probably benign
R7130:Adcy6 UTSW 15 98597229 missense probably benign
R7335:Adcy6 UTSW 15 98603876 missense probably benign 0.29
R7643:Adcy6 UTSW 15 98593568 missense probably benign
R7658:Adcy6 UTSW 15 98596067 missense probably benign 0.00
R7748:Adcy6 UTSW 15 98604556 missense probably benign 0.01
R7761:Adcy6 UTSW 15 98600014 missense probably damaging 1.00
R7774:Adcy6 UTSW 15 98596533 missense probably benign
R8259:Adcy6 UTSW 15 98601038 missense probably damaging 0.97
R8260:Adcy6 UTSW 15 98601038 missense probably damaging 0.97
X0020:Adcy6 UTSW 15 98598735 missense probably damaging 0.99
X0021:Adcy6 UTSW 15 98603942 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATACTCAGAAGGGCTGCAGTTC -3'
(R):5'- GGGATTTATGCCGCTATCTTCC -3'

Sequencing Primer
(F):5'- CTGCAGTTCTGAGAAAGTGCC -3'
(R):5'- CACTGTGCTGATCTGTGCCG -3'
Posted On2014-10-30