Mutagenetix > Incidental Mutation

Incidental Mutation 'R2358:Kif28'

246986

Institutional Source

Beutler Lab

Gene Symbol

Kif28

Ensembl Gene

ENSMUSG00000087236

Gene Name

kinesin family member 28

Synonyms

LOC383592, Gm1305

MMRRC Submission

040340-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.422) question?

Stock #

R2358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

179695297-179745271 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 179709459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 486 (H486Q)

Ref Sequence

ENSEMBL: ENSMUSP00000118935 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000221136]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000131716
AA Change: H486Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236
AA Change: H486Q

Domain	Start	End	E-Value	Type
KISc	3	331	1.02e-120	SMART
low complexity region	343	354	N/A	INTRINSIC
FHA	424	473	1.12e-3	SMART
Pfam:KIF1B	615	654	1.3e-7	PFAM
low complexity region	842	857	N/A	INTRINSIC
low complexity region	959	973	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211943
AA Change: H418Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221136
AA Change: H486Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,077,305		probably null	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Ankzf1	C	T	1: 75,195,251	H209Y	probably damaging	Het
Ate1	A	T	7: 130,516,165	M30K	probably damaging	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Cela1	A	G	15: 100,681,228	I183T	probably benign	Het
Copg2	A	T	6: 30,826,233	L259*	probably null	Het
Efcab7	T	A	4: 99,831,586		probably benign	Het
Fcrl5	A	G	3: 87,446,419	E357G	probably damaging	Het
Fzr1	C	T	10: 81,367,640		probably null	Het
Gm10696	G	A	3: 94,175,547	A319V	possibly damaging	Het
Gm10696	C	A	3: 94,175,548	A319S	possibly damaging	Het
Il12rb2	C	T	6: 67,298,195	A649T	probably damaging	Het
Itfg1	C	A	8: 85,738,129	V438F	probably damaging	Het
Jaml	A	C	9: 45,101,063	I283L	possibly damaging	Het
Lrch4	A	G	5: 137,638,548		probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mrpl32	A	T	13: 14,610,580	V157E	probably damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Myom2	G	A	8: 15,112,018	V984I	possibly damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nlrp4a	A	G	7: 26,464,198	D930G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr1351	T	C	10: 79,018,188	F289L	probably damaging	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Ovch2	A	T	7: 107,794,915	H110Q	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Pi4k2a	G	A	19: 42,090,692	R64Q	probably damaging	Het
Ptpn12	G	A	5: 20,998,692	P363S	probably damaging	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Ripor3	A	G	2: 167,983,865		probably benign	Het
Rpl13-ps3	A	G	14: 58,893,816		noncoding transcript	Het
Sap18b	G	A	8: 95,825,563	R67H	probably benign	Het
Sdhb	T	C	4: 140,973,000	V137A	probably damaging	Het
Shmt2	T	C	10: 127,518,028	T459A	probably benign	Het
Siglecg	A	G	7: 43,409,422	S200G	possibly damaging	Het
Slc6a15	T	G	10: 103,416,785	I603S	probably benign	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Spata31d1a	G	A	13: 59,703,888	S142L	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
St5	A	T	7: 109,556,446	S366T	probably benign	Het
Strip1	A	G	3: 107,615,819	V633A	probably benign	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Terb2	T	A	2: 122,198,432	C157S	probably benign	Het
Themis	T	A	10: 28,863,380	N615K	possibly damaging	Het
Tlnrd1	A	T	7: 83,882,280	D314E	probably benign	Het
Vmn1r205	T	A	13: 22,592,396	T179S	probably benign	Het
Vsig10l	G	A	7: 43,468,761	R689H	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Zfp423	G	T	8: 87,780,551	A1034D	possibly damaging	Het
Zfy2	T	C	Y: 2,107,272	E454G	possibly damaging	Het
Zyg11a	G	T	4: 108,196,146	Q440K	possibly damaging	Het

Other mutations in Kif28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Kif28	APN	1	179702516	missense	probably damaging	1.00
IGL00581:Kif28	APN	1	179739957	missense	probably benign	0.14
R0348:Kif28	UTSW	1	179731253	missense	probably damaging	1.00
R0388:Kif28	UTSW	1	179740089	missense	possibly damaging	0.71
R0412:Kif28	UTSW	1	179702526	missense	probably benign	0.01
R0788:Kif28	UTSW	1	179705223	unclassified	probably benign
R0960:Kif28	UTSW	1	179695805	nonsense	probably null
R1365:Kif28	UTSW	1	179739987	nonsense	probably null
R1420:Kif28	UTSW	1	179702397	missense	probably damaging	1.00
R1442:Kif28	UTSW	1	179705132	missense	possibly damaging	0.73
R1507:Kif28	UTSW	1	179736006	missense	probably damaging	1.00
R1818:Kif28	UTSW	1	179705754	missense	possibly damaging	0.66
R1819:Kif28	UTSW	1	179705754	missense	possibly damaging	0.66
R1903:Kif28	UTSW	1	179702523	missense	possibly damaging	0.63
R2221:Kif28	UTSW	1	179733111	missense	possibly damaging	0.80
R4916:Kif28	UTSW	1	179702520	missense	probably benign	0.09
R4943:Kif28	UTSW	1	179713951	missense	probably benign	0.02
R4967:Kif28	UTSW	1	179708442	missense	probably damaging	1.00
R4974:Kif28	UTSW	1	179698644	missense	probably damaging	0.98
R5152:Kif28	UTSW	1	179702538	missense	probably damaging	1.00
R5382:Kif28	UTSW	1	179700282	missense	probably damaging	1.00
R5649:Kif28	UTSW	1	179697771	splice site	probably null
R5999:Kif28	UTSW	1	179695790	missense	probably damaging	1.00
R6017:Kif28	UTSW	1	179699453	missense	probably benign	0.24
R6180:Kif28	UTSW	1	179697772	splice site	probably null
R6875:Kif28	UTSW	1	179735994	missense	probably damaging	0.98
R7400:Kif28	UTSW	1	179700274	missense	probably damaging	1.00
R7402:Kif28	UTSW	1	179740079	missense	probably benign	0.00
R7530:Kif28	UTSW	1	179708480	missense	probably benign	0.31
R7589:Kif28	UTSW	1	179731400	missense	probably benign	0.01
R7648:Kif28	UTSW	1	179709424	missense	possibly damaging	0.89
R7815:Kif28	UTSW	1	179735983	missense	probably damaging	1.00
R8030:Kif28	UTSW	1	179699064	missense	probably benign	0.04
R8050:Kif28	UTSW	1	179709449	missense	probably benign	0.00
R8088:Kif28	UTSW	1	179700354	missense	probably damaging	1.00
R8781:Kif28	UTSW	1	179697916	missense	probably benign	0.00
R8947:Kif28	UTSW	1	179716755	missense	possibly damaging	0.94
R9011:Kif28	UTSW	1	179702419	missense	possibly damaging	0.89
R9161:Kif28	UTSW	1	179698679	missense	probably benign	0.29
R9164:Kif28	UTSW	1	179705768	missense	probably damaging	1.00
R9358:Kif28	UTSW	1	179736130	missense	probably benign	0.09
Z1176:Kif28	UTSW	1	179733134	missense	probably benign	0.05
Z1177:Kif28	UTSW	1	179728219	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGAGACATTTCACAAGAGAGCC -3'
(R):5'- AATAGCATCCTCACTGTCTGCC -3'

Sequencing Primer
(F):5'- TTTCACAAGAGAGCCACCCCTAC -3'
(R):5'- TGCCAGCTCCCTGCACAC -3'

Posted On

2014-10-30