Mutagenetix > Incidental Mutation

Incidental Mutation 'R2358:Wt1'

246992

Institutional Source

Beutler Lab

Gene Symbol

Wt1

Ensembl Gene

ENSMUSG00000016458

Gene Name

Wilms tumor 1 homolog

Synonyms

Wt-1, D630046I19Rik

MMRRC Submission

040340-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105126529-105173616 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 105163428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111098] [ENSMUST00000111099] [ENSMUST00000133470] [ENSMUST00000143043] [ENSMUST00000146842] [ENSMUST00000213301]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111098

SMART Domains

Protein: ENSMUSP00000106727
Gene: ENSMUSG00000016458

Domain	Start	End	E-Value	Type
Pfam:WT1	1	160	5e-93	PFAM
ZnF_C2H2	162	186	1.33e-1	SMART
ZnF_C2H2	192	216	2.12e-4	SMART
ZnF_C2H2	222	244	1.92e-2	SMART
ZnF_C2H2	253	277	1.89e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111099

SMART Domains

Protein: ENSMUSP00000106728
Gene: ENSMUSG00000016458

Domain	Start	End	E-Value	Type
Pfam:WT1	1	119	6.2e-63	PFAM
Pfam:WT1	113	177	4.6e-27	PFAM
ZnF_C2H2	179	203	1.33e-1	SMART
ZnF_C2H2	209	233	2.12e-4	SMART
ZnF_C2H2	239	261	1.92e-2	SMART
ZnF_C2H2	267	291	1.89e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133470

SMART Domains

Protein: ENSMUSP00000120054
Gene: ENSMUSG00000016458

Domain	Start	End	E-Value	Type
Pfam:WT1	1	304	3.2e-165	PFAM
ZnF_C2H2	306	330	1.33e-1	SMART
ZnF_C2H2	336	360	2.12e-4	SMART
ZnF_C2H2	366	388	1.92e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139585

SMART Domains

Protein: ENSMUSP00000123592
Gene: ENSMUSG00000016458

Domain	Start	End	E-Value	Type
Pfam:WT1	1	235	9.8e-135	PFAM
ZnF_C2H2	237	261	1.33e-1	SMART
ZnF_C2H2	267	291	2.12e-4	SMART
ZnF_C2H2	297	319	1.92e-2	SMART
ZnF_C2H2	325	349	1.89e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143043

SMART Domains

Protein: ENSMUSP00000117891
Gene: ENSMUSG00000016458

Domain	Start	End	E-Value	Type
Pfam:WT1	69	389	1e-149	PFAM
ZnF_C2H2	391	415	1.33e-1	SMART
ZnF_C2H2	421	445	2.12e-4	SMART
ZnF_C2H2	451	473	1.92e-2	SMART
ZnF_C2H2	482	506	1.89e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146842

SMART Domains

Protein: ENSMUSP00000120702
Gene: ENSMUSG00000016458

Domain	Start	End	E-Value	Type
Pfam:WT1	1	225	5.1e-117	PFAM
Pfam:WT1	222	278	2.1e-26	PFAM
ZnF_C2H2	280	304	1.33e-1	SMART
ZnF_C2H2	310	334	2.12e-4	SMART
ZnF_C2H2	340	362	1.92e-2	SMART
ZnF_C2H2	371	395	1.89e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153944

Predicted Effect

probably benign
Transcript: ENSMUST00000213301

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It plays an essential role in the normal development of the urogenital system, and the orthologous human gene is mutated in a small subset of patients with Wilm's tumors. Alternative splicing has been noted for this gene, however, the full-length nature of these variants is not known. The mRNA for this gene has been shown to initiate translation from non-AUG (CUG) and AUG translation start sites, resulting in different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutants fail to develop normal kidneys or gonads, and on some genetic backgrounds, a spleen. Mutants have abnormalities of the heart, mesothelium and lungs and die between embryonic day 13.5 and birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,077,305		probably null	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Ankzf1	C	T	1: 75,195,251	H209Y	probably damaging	Het
Ate1	A	T	7: 130,516,165	M30K	probably damaging	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Cela1	A	G	15: 100,681,228	I183T	probably benign	Het
Copg2	A	T	6: 30,826,233	L259*	probably null	Het
Efcab7	T	A	4: 99,831,586		probably benign	Het
Fcrl5	A	G	3: 87,446,419	E357G	probably damaging	Het
Fzr1	C	T	10: 81,367,640		probably null	Het
Gm10696	G	A	3: 94,175,547	A319V	possibly damaging	Het
Gm10696	C	A	3: 94,175,548	A319S	possibly damaging	Het
Il12rb2	C	T	6: 67,298,195	A649T	probably damaging	Het
Itfg1	C	A	8: 85,738,129	V438F	probably damaging	Het
Jaml	A	C	9: 45,101,063	I283L	possibly damaging	Het
Kif28	A	T	1: 179,709,459	H486Q	probably damaging	Het
Lrch4	A	G	5: 137,638,548		probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mrpl32	A	T	13: 14,610,580	V157E	probably damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Myom2	G	A	8: 15,112,018	V984I	possibly damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nlrp4a	A	G	7: 26,464,198	D930G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr1351	T	C	10: 79,018,188	F289L	probably damaging	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Ovch2	A	T	7: 107,794,915	H110Q	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Pi4k2a	G	A	19: 42,090,692	R64Q	probably damaging	Het
Ptpn12	G	A	5: 20,998,692	P363S	probably damaging	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Ripor3	A	G	2: 167,983,865		probably benign	Het
Rpl13-ps3	A	G	14: 58,893,816		noncoding transcript	Het
Sap18b	G	A	8: 95,825,563	R67H	probably benign	Het
Sdhb	T	C	4: 140,973,000	V137A	probably damaging	Het
Shmt2	T	C	10: 127,518,028	T459A	probably benign	Het
Siglecg	A	G	7: 43,409,422	S200G	possibly damaging	Het
Slc6a15	T	G	10: 103,416,785	I603S	probably benign	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Spata31d1a	G	A	13: 59,703,888	S142L	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
St5	A	T	7: 109,556,446	S366T	probably benign	Het
Strip1	A	G	3: 107,615,819	V633A	probably benign	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Terb2	T	A	2: 122,198,432	C157S	probably benign	Het
Themis	T	A	10: 28,863,380	N615K	possibly damaging	Het
Tlnrd1	A	T	7: 83,882,280	D314E	probably benign	Het
Vmn1r205	T	A	13: 22,592,396	T179S	probably benign	Het
Vsig10l	G	A	7: 43,468,761	R689H	probably benign	Het
Zfp423	G	T	8: 87,780,551	A1034D	possibly damaging	Het
Zfy2	T	C	Y: 2,107,272	E454G	possibly damaging	Het
Zyg11a	G	T	4: 108,196,146	Q440K	possibly damaging	Het

Other mutations in Wt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Wt1	APN	2	105144141	critical splice acceptor site	probably null
IGL00846:Wt1	APN	2	105166957	missense	probably damaging	1.00
IGL01411:Wt1	APN	2	105132974	missense	probably damaging	1.00
IGL02936:Wt1	APN	2	105169039	missense	probably damaging	1.00
IGL03063:Wt1	APN	2	105170023	splice site	probably null
R0127:Wt1	UTSW	2	105133457	missense	probably damaging	1.00
R1462:Wt1	UTSW	2	105166831	missense	probably damaging	1.00
R1462:Wt1	UTSW	2	105166831	missense	probably damaging	1.00
R2061:Wt1	UTSW	2	105131157	splice site	probably null
R2284:Wt1	UTSW	2	105172321	missense	probably benign	0.43
R3711:Wt1	UTSW	2	105163428	splice site	probably benign
R5096:Wt1	UTSW	2	105143125	missense	probably damaging	1.00
R5590:Wt1	UTSW	2	105127284	missense	probably damaging	1.00
R5984:Wt1	UTSW	2	105172252	missense	probably benign	0.44
R6821:Wt1	UTSW	2	105172267	missense	probably damaging	1.00
R7128:Wt1	UTSW	2	105127325	missense	probably benign	0.04
R7698:Wt1	UTSW	2	105126816	missense	probably benign	0.33
R7913:Wt1	UTSW	2	105166860	missense	probably damaging	0.98
R8005:Wt1	UTSW	2	105127444	critical splice donor site	probably null
R8944:Wt1	UTSW	2	105127239	missense	possibly damaging	0.92
R9032:Wt1	UTSW	2	105126815	missense	probably benign	0.18
R9569:Wt1	UTSW	2	105163366	missense	possibly damaging	0.93
Z1176:Wt1	UTSW	2	105127107	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCCATGGAGTGAGGTAAGAC -3'
(R):5'- ATTCAAGTGCAGATGACCCC -3'

Sequencing Primer
(F):5'- GACTCTGTATTTCCAAAAGGTGACC -3'
(R):5'- GAACTGTACCACTCACCAGG -3'

Posted On

2014-10-30