Incidental Mutation 'R2358:Wt1'
ID 246992
Institutional Source Beutler Lab
Gene Symbol Wt1
Ensembl Gene ENSMUSG00000016458
Gene Name Wilms tumor 1 homolog
Synonyms Wt-1, D630046I19Rik
MMRRC Submission 040340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 105126529-105173616 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 105163428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111098] [ENSMUST00000111099] [ENSMUST00000133470] [ENSMUST00000143043] [ENSMUST00000146842] [ENSMUST00000213301]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000111098
SMART Domains Protein: ENSMUSP00000106727
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 160 5e-93 PFAM
ZnF_C2H2 162 186 1.33e-1 SMART
ZnF_C2H2 192 216 2.12e-4 SMART
ZnF_C2H2 222 244 1.92e-2 SMART
ZnF_C2H2 253 277 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111099
SMART Domains Protein: ENSMUSP00000106728
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 119 6.2e-63 PFAM
Pfam:WT1 113 177 4.6e-27 PFAM
ZnF_C2H2 179 203 1.33e-1 SMART
ZnF_C2H2 209 233 2.12e-4 SMART
ZnF_C2H2 239 261 1.92e-2 SMART
ZnF_C2H2 267 291 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133470
SMART Domains Protein: ENSMUSP00000120054
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 304 3.2e-165 PFAM
ZnF_C2H2 306 330 1.33e-1 SMART
ZnF_C2H2 336 360 2.12e-4 SMART
ZnF_C2H2 366 388 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139585
SMART Domains Protein: ENSMUSP00000123592
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 235 9.8e-135 PFAM
ZnF_C2H2 237 261 1.33e-1 SMART
ZnF_C2H2 267 291 2.12e-4 SMART
ZnF_C2H2 297 319 1.92e-2 SMART
ZnF_C2H2 325 349 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143043
SMART Domains Protein: ENSMUSP00000117891
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 69 389 1e-149 PFAM
ZnF_C2H2 391 415 1.33e-1 SMART
ZnF_C2H2 421 445 2.12e-4 SMART
ZnF_C2H2 451 473 1.92e-2 SMART
ZnF_C2H2 482 506 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146842
SMART Domains Protein: ENSMUSP00000120702
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 225 5.1e-117 PFAM
Pfam:WT1 222 278 2.1e-26 PFAM
ZnF_C2H2 280 304 1.33e-1 SMART
ZnF_C2H2 310 334 2.12e-4 SMART
ZnF_C2H2 340 362 1.92e-2 SMART
ZnF_C2H2 371 395 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153944
Predicted Effect probably benign
Transcript: ENSMUST00000213301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It plays an essential role in the normal development of the urogenital system, and the orthologous human gene is mutated in a small subset of patients with Wilm's tumors. Alternative splicing has been noted for this gene, however, the full-length nature of these variants is not known. The mRNA for this gene has been shown to initiate translation from non-AUG (CUG) and AUG translation start sites, resulting in different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutants fail to develop normal kidneys or gonads, and on some genetic backgrounds, a spleen. Mutants have abnormalities of the heart, mesothelium and lungs and die between embryonic day 13.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Ptpn12 G A 5: 20,998,692 P363S probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Sdhb T C 4: 140,973,000 V137A probably damaging Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Wt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Wt1 APN 2 105144141 critical splice acceptor site probably null
IGL00846:Wt1 APN 2 105166957 missense probably damaging 1.00
IGL01411:Wt1 APN 2 105132974 missense probably damaging 1.00
IGL02936:Wt1 APN 2 105169039 missense probably damaging 1.00
IGL03063:Wt1 APN 2 105170023 splice site probably null
R0127:Wt1 UTSW 2 105133457 missense probably damaging 1.00
R1462:Wt1 UTSW 2 105166831 missense probably damaging 1.00
R1462:Wt1 UTSW 2 105166831 missense probably damaging 1.00
R2061:Wt1 UTSW 2 105131157 splice site probably null
R2284:Wt1 UTSW 2 105172321 missense probably benign 0.43
R3711:Wt1 UTSW 2 105163428 splice site probably benign
R5096:Wt1 UTSW 2 105143125 missense probably damaging 1.00
R5590:Wt1 UTSW 2 105127284 missense probably damaging 1.00
R5984:Wt1 UTSW 2 105172252 missense probably benign 0.44
R6821:Wt1 UTSW 2 105172267 missense probably damaging 1.00
R7128:Wt1 UTSW 2 105127325 missense probably benign 0.04
R7698:Wt1 UTSW 2 105126816 missense probably benign 0.33
R7913:Wt1 UTSW 2 105166860 missense probably damaging 0.98
R8005:Wt1 UTSW 2 105127444 critical splice donor site probably null
R8944:Wt1 UTSW 2 105127239 missense possibly damaging 0.92
R9032:Wt1 UTSW 2 105126815 missense probably benign 0.18
R9569:Wt1 UTSW 2 105163366 missense possibly damaging 0.93
Z1176:Wt1 UTSW 2 105127107 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCATGGAGTGAGGTAAGAC -3'
(R):5'- ATTCAAGTGCAGATGACCCC -3'

Sequencing Primer
(F):5'- GACTCTGTATTTCCAAAAGGTGACC -3'
(R):5'- GAACTGTACCACTCACCAGG -3'
Posted On 2014-10-30