Incidental Mutation 'R2358:Wt1'
ID 246992
Institutional Source Beutler Lab
Gene Symbol Wt1
Ensembl Gene ENSMUSG00000016458
Gene Name WT1 transcription factor
Synonyms D630046I19Rik, Wt-1, Wilms tumor 1 homolog
MMRRC Submission 040340-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 104956874-105003959 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 104993773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111098] [ENSMUST00000111099] [ENSMUST00000133470] [ENSMUST00000143043] [ENSMUST00000146842] [ENSMUST00000213301]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000111098
SMART Domains Protein: ENSMUSP00000106727
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 160 5e-93 PFAM
ZnF_C2H2 162 186 1.33e-1 SMART
ZnF_C2H2 192 216 2.12e-4 SMART
ZnF_C2H2 222 244 1.92e-2 SMART
ZnF_C2H2 253 277 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111099
SMART Domains Protein: ENSMUSP00000106728
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 119 6.2e-63 PFAM
Pfam:WT1 113 177 4.6e-27 PFAM
ZnF_C2H2 179 203 1.33e-1 SMART
ZnF_C2H2 209 233 2.12e-4 SMART
ZnF_C2H2 239 261 1.92e-2 SMART
ZnF_C2H2 267 291 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133470
SMART Domains Protein: ENSMUSP00000120054
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 304 3.2e-165 PFAM
ZnF_C2H2 306 330 1.33e-1 SMART
ZnF_C2H2 336 360 2.12e-4 SMART
ZnF_C2H2 366 388 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139585
SMART Domains Protein: ENSMUSP00000123592
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 235 9.8e-135 PFAM
ZnF_C2H2 237 261 1.33e-1 SMART
ZnF_C2H2 267 291 2.12e-4 SMART
ZnF_C2H2 297 319 1.92e-2 SMART
ZnF_C2H2 325 349 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143043
SMART Domains Protein: ENSMUSP00000117891
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 69 389 1e-149 PFAM
ZnF_C2H2 391 415 1.33e-1 SMART
ZnF_C2H2 421 445 2.12e-4 SMART
ZnF_C2H2 451 473 1.92e-2 SMART
ZnF_C2H2 482 506 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146842
SMART Domains Protein: ENSMUSP00000120702
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 225 5.1e-117 PFAM
Pfam:WT1 222 278 2.1e-26 PFAM
ZnF_C2H2 280 304 1.33e-1 SMART
ZnF_C2H2 310 334 2.12e-4 SMART
ZnF_C2H2 340 362 1.92e-2 SMART
ZnF_C2H2 371 395 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153944
Predicted Effect probably benign
Transcript: ENSMUST00000213301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It plays an essential role in the normal development of the urogenital system, and the orthologous human gene is mutated in a small subset of patients with Wilm's tumors. Alternative splicing has been noted for this gene, however, the full-length nature of these variants is not known. The mRNA for this gene has been shown to initiate translation from non-AUG (CUG) and AUG translation start sites, resulting in different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutants fail to develop normal kidneys or gonads, and on some genetic backgrounds, a spleen. Mutants have abnormalities of the heart, mesothelium and lungs and die between embryonic day 13.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,215,368 (GRCm39) probably null Het
Aif1l T A 2: 31,859,763 (GRCm39) F94L probably damaging Het
Ankzf1 C T 1: 75,171,895 (GRCm39) H209Y probably damaging Het
Ate1 A T 7: 130,117,895 (GRCm39) M30K probably damaging Het
Cd27 A G 6: 125,210,281 (GRCm39) Y189H probably damaging Het
Cela1 A G 15: 100,579,109 (GRCm39) I183T probably benign Het
Copg2 A T 6: 30,803,168 (GRCm39) L259* probably null Het
Dennd2b A T 7: 109,155,653 (GRCm39) S366T probably benign Het
Efcab7 T A 4: 99,719,823 (GRCm39) probably benign Het
Fcrl5 A G 3: 87,353,726 (GRCm39) E357G probably damaging Het
Fzr1 C T 10: 81,203,474 (GRCm39) probably null Het
Il12rb2 C T 6: 67,275,179 (GRCm39) A649T probably damaging Het
Itfg1 C A 8: 86,464,758 (GRCm39) V438F probably damaging Het
Jaml A C 9: 45,012,361 (GRCm39) I283L possibly damaging Het
Kif28 A T 1: 179,537,024 (GRCm39) H486Q probably damaging Het
Lrch4 A G 5: 137,636,810 (GRCm39) probably benign Het
Lrfn2 A G 17: 49,378,188 (GRCm39) E423G possibly damaging Het
Lrp4 T A 2: 91,332,299 (GRCm39) N1665K probably benign Het
Mrpl32 A T 13: 14,785,165 (GRCm39) V157E probably damaging Het
Mta3 A G 17: 84,070,417 (GRCm39) I193V probably damaging Het
Myom2 G A 8: 15,162,018 (GRCm39) V984I possibly damaging Het
Nedd4l G A 18: 65,342,790 (GRCm39) V909I possibly damaging Het
Nlrp4a A G 7: 26,163,623 (GRCm39) D930G probably benign Het
Or10al5 T A 17: 38,063,271 (GRCm39) C175* probably null Het
Or5d47 A T 2: 87,804,066 (GRCm39) N314K probably benign Het
Or7a35 T C 10: 78,854,022 (GRCm39) F289L probably damaging Het
Ovch2 A T 7: 107,394,122 (GRCm39) H110Q probably damaging Het
Pcnx3 G A 19: 5,733,367 (GRCm39) Q155* probably null Het
Pcnx3 C G 19: 5,733,368 (GRCm39) L1F probably null Het
Pi4k2a G A 19: 42,079,131 (GRCm39) R64Q probably damaging Het
Ptpn12 G A 5: 21,203,690 (GRCm39) P363S probably damaging Het
Rbm27 T C 18: 42,425,177 (GRCm39) probably benign Het
Ripor3 A G 2: 167,825,785 (GRCm39) probably benign Het
Rpl13-ps3 A G 14: 59,131,265 (GRCm39) noncoding transcript Het
Sap18b G A 8: 96,552,191 (GRCm39) R67H probably benign Het
Sdhb T C 4: 140,700,311 (GRCm39) V137A probably damaging Het
Shmt2 T C 10: 127,353,897 (GRCm39) T459A probably benign Het
Siglecg A G 7: 43,058,846 (GRCm39) S200G possibly damaging Het
Slc6a15 T G 10: 103,252,646 (GRCm39) I603S probably benign Het
Smtn A T 11: 3,482,865 (GRCm39) probably null Het
Spata31d1a G A 13: 59,851,702 (GRCm39) S142L probably benign Het
Spopfm2 G A 3: 94,082,854 (GRCm39) A319V possibly damaging Het
Spopfm2 C A 3: 94,082,855 (GRCm39) A319S possibly damaging Het
Spopl C T 2: 23,427,392 (GRCm39) R221Q probably damaging Het
Strip1 A G 3: 107,523,135 (GRCm39) V633A probably benign Het
Sun2 A G 15: 79,612,114 (GRCm39) S522P possibly damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Terb2 T A 2: 122,028,913 (GRCm39) C157S probably benign Het
Themis T A 10: 28,739,376 (GRCm39) N615K possibly damaging Het
Tlnrd1 A T 7: 83,531,488 (GRCm39) D314E probably benign Het
Vmn1r205 T A 13: 22,776,566 (GRCm39) T179S probably benign Het
Vsig10l G A 7: 43,118,185 (GRCm39) R689H probably benign Het
Zfp423 G T 8: 88,507,179 (GRCm39) A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 (GRCm39) E454G possibly damaging Het
Zyg11a G T 4: 108,053,343 (GRCm39) Q440K possibly damaging Het
Other mutations in Wt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Wt1 APN 2 104,974,486 (GRCm39) critical splice acceptor site probably null
IGL00846:Wt1 APN 2 104,997,302 (GRCm39) missense probably damaging 1.00
IGL01411:Wt1 APN 2 104,963,319 (GRCm39) missense probably damaging 1.00
IGL02936:Wt1 APN 2 104,999,384 (GRCm39) missense probably damaging 1.00
IGL03063:Wt1 APN 2 105,000,368 (GRCm39) splice site probably null
R0127:Wt1 UTSW 2 104,963,802 (GRCm39) missense probably damaging 1.00
R1462:Wt1 UTSW 2 104,997,176 (GRCm39) missense probably damaging 1.00
R1462:Wt1 UTSW 2 104,997,176 (GRCm39) missense probably damaging 1.00
R2061:Wt1 UTSW 2 104,961,502 (GRCm39) splice site probably null
R2284:Wt1 UTSW 2 105,002,666 (GRCm39) missense probably benign 0.43
R3711:Wt1 UTSW 2 104,993,773 (GRCm39) splice site probably benign
R5096:Wt1 UTSW 2 104,973,470 (GRCm39) missense probably damaging 1.00
R5590:Wt1 UTSW 2 104,957,629 (GRCm39) missense probably damaging 1.00
R5984:Wt1 UTSW 2 105,002,597 (GRCm39) missense probably benign 0.44
R6821:Wt1 UTSW 2 105,002,612 (GRCm39) missense probably damaging 1.00
R7128:Wt1 UTSW 2 104,957,670 (GRCm39) missense probably benign 0.04
R7698:Wt1 UTSW 2 104,957,161 (GRCm39) missense probably benign 0.33
R7913:Wt1 UTSW 2 104,997,205 (GRCm39) missense probably damaging 0.98
R8005:Wt1 UTSW 2 104,957,789 (GRCm39) critical splice donor site probably null
R8944:Wt1 UTSW 2 104,957,584 (GRCm39) missense possibly damaging 0.92
R9032:Wt1 UTSW 2 104,957,160 (GRCm39) missense probably benign 0.18
R9569:Wt1 UTSW 2 104,993,711 (GRCm39) missense possibly damaging 0.93
Z1176:Wt1 UTSW 2 104,957,452 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCATGGAGTGAGGTAAGAC -3'
(R):5'- ATTCAAGTGCAGATGACCCC -3'

Sequencing Primer
(F):5'- GACTCTGTATTTCCAAAAGGTGACC -3'
(R):5'- GAACTGTACCACTCACCAGG -3'
Posted On 2014-10-30