Incidental Mutation 'R2358:Sdhb'
ID 247003
Institutional Source Beutler Lab
Gene Symbol Sdhb
Ensembl Gene ENSMUSG00000009863
Gene Name succinate dehydrogenase complex, subunit B, iron sulfur (Ip)
Synonyms
MMRRC Submission 040340-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 140961203-140979193 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140973000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000010007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010007]
AlphaFold Q9CQA3
Predicted Effect probably damaging
Transcript: ENSMUST00000010007
AA Change: V137A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010007
Gene: ENSMUSG00000009863
AA Change: V137A

DomainStartEndE-ValueType
Pfam:Fer2_3 43 150 5e-36 PFAM
Pfam:Fer4_8 185 259 2.2e-9 PFAM
Pfam:Fer4_17 187 260 1.8e-11 PFAM
Pfam:Fer4_18 193 262 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129181
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene is involved in the hypoxia-induced RNA editing pathway in monocytes. Heterozygous compound KOs show reduced increase in blood hemoglobin under hypoxic conditions. Homozygous inactivation of this gene results in complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Ptpn12 G A 5: 20,998,692 P363S probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Sdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Sdhb APN 4 140977480 missense probably damaging 1.00
IGL01542:Sdhb APN 4 140972967 missense probably benign
IGL01790:Sdhb APN 4 140973727 missense probably benign
IGL03003:Sdhb APN 4 140973000 missense probably damaging 1.00
R1070:Sdhb UTSW 4 140971236 splice site probably benign
R1971:Sdhb UTSW 4 140972949 missense possibly damaging 0.81
R2008:Sdhb UTSW 4 140979029 missense probably damaging 1.00
R3821:Sdhb UTSW 4 140979088 nonsense probably null
R4202:Sdhb UTSW 4 140979068 missense possibly damaging 0.64
R4611:Sdhb UTSW 4 140972915 missense probably damaging 1.00
R4782:Sdhb UTSW 4 140977466 missense possibly damaging 0.59
R4799:Sdhb UTSW 4 140977466 missense possibly damaging 0.59
R6235:Sdhb UTSW 4 140973673 missense probably damaging 0.98
R6426:Sdhb UTSW 4 140973718 missense probably benign 0.01
R6768:Sdhb UTSW 4 140979053 missense probably damaging 1.00
R6787:Sdhb UTSW 4 140976190 missense probably damaging 1.00
R7255:Sdhb UTSW 4 140977418 missense possibly damaging 0.55
R7520:Sdhb UTSW 4 140966571 missense possibly damaging 0.88
R9335:Sdhb UTSW 4 140972939 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACATCCTCTGTTAGCGCAG -3'
(R):5'- TGGGAAGGGGTTCCTAATGC -3'

Sequencing Primer
(F):5'- CAGCTACTGATGTGAGCAGTG -3'
(R):5'- AATGCCTCTGTGGACTCTGGAAAC -3'
Posted On 2014-10-30