Incidental Mutation 'R2358:Ptpn12'
ID 247004
Institutional Source Beutler Lab
Gene Symbol Ptpn12
Ensembl Gene ENSMUSG00000028771
Gene Name protein tyrosine phosphatase, non-receptor type 12
Synonyms P19-PTP, PTP-PEST, PTP-P19
MMRRC Submission 040340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 20986645-21055911 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20998692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 363 (P363S)
Ref Sequence ENSEMBL: ENSMUSP00000030556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813]
AlphaFold P35831
Predicted Effect probably damaging
Transcript: ENSMUST00000030556
AA Change: P363S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: P363S

DomainStartEndE-ValueType
PTPc 27 295 2.14e-126 SMART
Blast:PTPc 338 399 7e-12 BLAST
low complexity region 499 518 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148711
Predicted Effect probably benign
Transcript: ENSMUST00000151813
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Sdhb T C 4: 140,973,000 V137A probably damaging Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Ptpn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ptpn12 APN 5 21029850 missense probably damaging 1.00
IGL00226:Ptpn12 APN 5 20998668 missense probably damaging 1.00
IGL01432:Ptpn12 APN 5 20998555 nonsense probably null
IGL02285:Ptpn12 APN 5 21055713 missense probably benign 0.40
IGL02488:Ptpn12 APN 5 21022062 missense possibly damaging 0.72
IGL02550:Ptpn12 APN 5 20998139 missense probably benign 0.00
IGL02640:Ptpn12 APN 5 21019246 missense probably damaging 1.00
IGL02652:Ptpn12 APN 5 21002437 missense probably benign 0.04
IGL03130:Ptpn12 APN 5 21002612 unclassified probably benign
R0531:Ptpn12 UTSW 5 20998483 missense possibly damaging 0.53
R0948:Ptpn12 UTSW 5 20998043 missense probably benign
R1018:Ptpn12 UTSW 5 21029869 missense possibly damaging 0.94
R1184:Ptpn12 UTSW 5 20998356 missense possibly damaging 0.86
R1699:Ptpn12 UTSW 5 20998170 missense probably benign 0.01
R1938:Ptpn12 UTSW 5 20993263 missense probably damaging 1.00
R1952:Ptpn12 UTSW 5 20998310 missense probably benign 0.34
R2152:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2153:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2154:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2267:Ptpn12 UTSW 5 20998411 missense probably damaging 0.98
R3551:Ptpn12 UTSW 5 20989049 missense possibly damaging 0.67
R3931:Ptpn12 UTSW 5 21001323 missense probably benign 0.00
R4013:Ptpn12 UTSW 5 20992743 missense probably benign 0.05
R4039:Ptpn12 UTSW 5 21002510 nonsense probably null
R4501:Ptpn12 UTSW 5 21019280 missense probably damaging 1.00
R4748:Ptpn12 UTSW 5 21005385 nonsense probably null
R4754:Ptpn12 UTSW 5 20998589 missense probably benign 0.34
R4963:Ptpn12 UTSW 5 21015708 splice site probably null
R5160:Ptpn12 UTSW 5 20997831 missense probably damaging 1.00
R5581:Ptpn12 UTSW 5 21015726 missense probably damaging 1.00
R5789:Ptpn12 UTSW 5 20989015 missense possibly damaging 0.92
R5836:Ptpn12 UTSW 5 21009546 nonsense probably null
R6383:Ptpn12 UTSW 5 20987468 nonsense probably null
R6883:Ptpn12 UTSW 5 21055713 missense probably benign 0.40
R7544:Ptpn12 UTSW 5 21009511 missense probably damaging 1.00
R7885:Ptpn12 UTSW 5 20998525 missense possibly damaging 0.54
R7915:Ptpn12 UTSW 5 21009451 missense probably damaging 1.00
R7960:Ptpn12 UTSW 5 21055689 missense probably benign 0.01
R7976:Ptpn12 UTSW 5 21002633 nonsense probably null
R8032:Ptpn12 UTSW 5 20998043 missense probably benign
R8224:Ptpn12 UTSW 5 20998658 missense probably damaging 1.00
R8473:Ptpn12 UTSW 5 20998359 missense probably benign 0.00
R8823:Ptpn12 UTSW 5 20998623 missense probably damaging 1.00
R9375:Ptpn12 UTSW 5 21019214 missense probably benign 0.21
R9613:Ptpn12 UTSW 5 20998623 missense probably damaging 1.00
R9707:Ptpn12 UTSW 5 21002622 missense probably damaging 0.99
X0004:Ptpn12 UTSW 5 21019296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCTTGGAGAGGGACTTTC -3'
(R):5'- GGTGCCTCTGCTTCATAGAC -3'

Sequencing Primer
(F):5'- CTTGGAGAGGGACTTTCTTAATCTC -3'
(R):5'- GCCTCTGCTTCATAGACTAGAGG -3'
Posted On 2014-10-30