Mutagenetix > Incidental Mutation

Incidental Mutation 'R2358:Il12rb2'

247008

Institutional Source

Beutler Lab

Gene Symbol

Il12rb2

Ensembl Gene

ENSMUSG00000018341

Gene Name

interleukin 12 receptor, beta 2

Synonyms

IL-12RB2, Ifnm, A930027I18Rik

MMRRC Submission

040340-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67291318-67376188 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 67298195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 649 (A649T)

Ref Sequence

ENSEMBL: ENSMUSP00000010605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018485] [ENSMUST00000042990] [ENSMUST00000117441]

AlphaFold

P97378

Predicted Effect

probably damaging
Transcript: ENSMUST00000018485
AA Change: A649T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: A649T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Lep_receptor_Ig	28	120	6.4e-20	PFAM
FN3	137	225	2.41e0	SMART
FN3	240	320	3.4e-4	SMART
Blast:FN3	340	434	2e-40	BLAST
FN3	436	525	3.17e-4	SMART
FN3	534	622	6.45e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000042990

SMART Domains

Protein: ENSMUSP00000039110
Gene: ENSMUSG00000036371

Domain	Start	End	E-Value	Type
Pfam:IHABP4_N	5	152	7.4e-42	PFAM
HABP4_PAI-RBP1	189	313	2.73e-44	SMART
low complexity region	362	384	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117441
AA Change: A315T

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113267
Gene: ENSMUSG00000018341
AA Change: A315T

Domain	Start	End	E-Value	Type
Blast:FN3	6	100	1e-41	BLAST
FN3	102	191	3.17e-4	SMART
FN3	200	288	6.45e-5	SMART

Meta Mutation Damage Score

0.3299

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,077,305		probably null	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Ankzf1	C	T	1: 75,195,251	H209Y	probably damaging	Het
Ate1	A	T	7: 130,516,165	M30K	probably damaging	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Cela1	A	G	15: 100,681,228	I183T	probably benign	Het
Copg2	A	T	6: 30,826,233	L259*	probably null	Het
Efcab7	T	A	4: 99,831,586		probably benign	Het
Fcrl5	A	G	3: 87,446,419	E357G	probably damaging	Het
Fzr1	C	T	10: 81,367,640		probably null	Het
Gm10696	G	A	3: 94,175,547	A319V	possibly damaging	Het
Gm10696	C	A	3: 94,175,548	A319S	possibly damaging	Het
Itfg1	C	A	8: 85,738,129	V438F	probably damaging	Het
Jaml	A	C	9: 45,101,063	I283L	possibly damaging	Het
Kif28	A	T	1: 179,709,459	H486Q	probably damaging	Het
Lrch4	A	G	5: 137,638,548		probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mrpl32	A	T	13: 14,610,580	V157E	probably damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Myom2	G	A	8: 15,112,018	V984I	possibly damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nlrp4a	A	G	7: 26,464,198	D930G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr1351	T	C	10: 79,018,188	F289L	probably damaging	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Ovch2	A	T	7: 107,794,915	H110Q	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Pi4k2a	G	A	19: 42,090,692	R64Q	probably damaging	Het
Ptpn12	G	A	5: 20,998,692	P363S	probably damaging	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Ripor3	A	G	2: 167,983,865		probably benign	Het
Rpl13-ps3	A	G	14: 58,893,816		noncoding transcript	Het
Sap18b	G	A	8: 95,825,563	R67H	probably benign	Het
Sdhb	T	C	4: 140,973,000	V137A	probably damaging	Het
Shmt2	T	C	10: 127,518,028	T459A	probably benign	Het
Siglecg	A	G	7: 43,409,422	S200G	possibly damaging	Het
Slc6a15	T	G	10: 103,416,785	I603S	probably benign	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Spata31d1a	G	A	13: 59,703,888	S142L	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
St5	A	T	7: 109,556,446	S366T	probably benign	Het
Strip1	A	G	3: 107,615,819	V633A	probably benign	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Terb2	T	A	2: 122,198,432	C157S	probably benign	Het
Themis	T	A	10: 28,863,380	N615K	possibly damaging	Het
Tlnrd1	A	T	7: 83,882,280	D314E	probably benign	Het
Vmn1r205	T	A	13: 22,592,396	T179S	probably benign	Het
Vsig10l	G	A	7: 43,468,761	R689H	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Zfp423	G	T	8: 87,780,551	A1034D	possibly damaging	Het
Zfy2	T	C	Y: 2,107,272	E454G	possibly damaging	Het
Zyg11a	G	T	4: 108,196,146	Q440K	possibly damaging	Het

Other mutations in Il12rb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00584:Il12rb2	APN	6	67357692	missense	probably damaging	0.98
IGL00767:Il12rb2	APN	6	67303562	missense	possibly damaging	0.63
IGL00835:Il12rb2	APN	6	67360567	missense	probably damaging	0.99
IGL00864:Il12rb2	APN	6	67336754	missense	probably benign
IGL00965:Il12rb2	APN	6	67360577	missense	probably damaging	0.98
IGL01161:Il12rb2	APN	6	67361865	splice site	probably benign
IGL01980:Il12rb2	APN	6	67360535	missense	probably benign
IGL02246:Il12rb2	APN	6	67308956	critical splice donor site	probably null
IGL02807:Il12rb2	APN	6	67351316	missense	probably damaging	1.00
R0003:Il12rb2	UTSW	6	67316286	missense	probably damaging	1.00
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0079:Il12rb2	UTSW	6	67361905	missense	probably benign	0.00
R0462:Il12rb2	UTSW	6	67303610	missense	possibly damaging	0.95
R0709:Il12rb2	UTSW	6	67298904	splice site	probably benign
R0828:Il12rb2	UTSW	6	67356707	missense	probably benign
R1051:Il12rb2	UTSW	6	67356735	missense	probably benign
R1191:Il12rb2	UTSW	6	67298216	missense	possibly damaging	0.90
R1446:Il12rb2	UTSW	6	67309143	missense	probably benign
R1559:Il12rb2	UTSW	6	67356592	missense	probably benign	0.12
R1677:Il12rb2	UTSW	6	67303501	missense	probably damaging	1.00
R1689:Il12rb2	UTSW	6	67336760	missense	probably benign	0.01
R1907:Il12rb2	UTSW	6	67295286	nonsense	probably null
R1952:Il12rb2	UTSW	6	67292316	missense	probably damaging	0.99
R2048:Il12rb2	UTSW	6	67360545	missense	probably benign	0.05
R2074:Il12rb2	UTSW	6	67360552	missense	probably damaging	1.00
R2351:Il12rb2	UTSW	6	67361944	nonsense	probably null
R2680:Il12rb2	UTSW	6	67354805	missense	possibly damaging	0.94
R2920:Il12rb2	UTSW	6	67360568	missense	probably damaging	0.96
R3107:Il12rb2	UTSW	6	67360798	missense	probably damaging	1.00
R4420:Il12rb2	UTSW	6	67316410	splice site	probably null
R4838:Il12rb2	UTSW	6	67309137	missense	probably damaging	1.00
R5391:Il12rb2	UTSW	6	67292420	missense	probably benign	0.24
R5532:Il12rb2	UTSW	6	67292262	missense	probably damaging	1.00
R5696:Il12rb2	UTSW	6	67295278	missense	possibly damaging	0.94
R5704:Il12rb2	UTSW	6	67292213	missense	possibly damaging	0.53
R5891:Il12rb2	UTSW	6	67360690	missense	probably damaging	0.97
R6482:Il12rb2	UTSW	6	67356686	missense	probably damaging	1.00
R6749:Il12rb2	UTSW	6	67361966	start gained	probably benign
R6813:Il12rb2	UTSW	6	67292374	missense	probably damaging	0.98
R6957:Il12rb2	UTSW	6	67292652	missense	possibly damaging	0.60
R7312:Il12rb2	UTSW	6	67356633	missense	probably benign	0.29
R7361:Il12rb2	UTSW	6	67303466	missense	possibly damaging	0.48
R7813:Il12rb2	UTSW	6	67356651	missense	possibly damaging	0.72
R7992:Il12rb2	UTSW	6	67351327	nonsense	probably null
R8422:Il12rb2	UTSW	6	67360816	missense	probably benign	0.20
R8752:Il12rb2	UTSW	6	67351281	missense	probably damaging	1.00
R9648:Il12rb2	UTSW	6	67356603	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TGCATTCAGCCACAATGGTT -3'
(R):5'- GCCTTTAGAATATATAATTGAGCCCC -3'

Sequencing Primer
(F):5'- GCCTGTAAACTCAGTATTGCAGG -3'
(R):5'- AACTCACTTTGTAGACCAGGCTGG -3'

Posted On

2014-10-30