Incidental Mutation 'R2358:Nlrp4a'
ID 247010
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 040340-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26163623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 930 (D930G)
Ref Sequence ENSEMBL: ENSMUSP00000112441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: D930G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: D930G

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: D930G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: D930G

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: D930G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.3285 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,215,368 (GRCm39) probably null Het
Aif1l T A 2: 31,859,763 (GRCm39) F94L probably damaging Het
Ankzf1 C T 1: 75,171,895 (GRCm39) H209Y probably damaging Het
Ate1 A T 7: 130,117,895 (GRCm39) M30K probably damaging Het
Cd27 A G 6: 125,210,281 (GRCm39) Y189H probably damaging Het
Cela1 A G 15: 100,579,109 (GRCm39) I183T probably benign Het
Copg2 A T 6: 30,803,168 (GRCm39) L259* probably null Het
Dennd2b A T 7: 109,155,653 (GRCm39) S366T probably benign Het
Efcab7 T A 4: 99,719,823 (GRCm39) probably benign Het
Fcrl5 A G 3: 87,353,726 (GRCm39) E357G probably damaging Het
Fzr1 C T 10: 81,203,474 (GRCm39) probably null Het
Il12rb2 C T 6: 67,275,179 (GRCm39) A649T probably damaging Het
Itfg1 C A 8: 86,464,758 (GRCm39) V438F probably damaging Het
Jaml A C 9: 45,012,361 (GRCm39) I283L possibly damaging Het
Kif28 A T 1: 179,537,024 (GRCm39) H486Q probably damaging Het
Lrch4 A G 5: 137,636,810 (GRCm39) probably benign Het
Lrfn2 A G 17: 49,378,188 (GRCm39) E423G possibly damaging Het
Lrp4 T A 2: 91,332,299 (GRCm39) N1665K probably benign Het
Mrpl32 A T 13: 14,785,165 (GRCm39) V157E probably damaging Het
Mta3 A G 17: 84,070,417 (GRCm39) I193V probably damaging Het
Myom2 G A 8: 15,162,018 (GRCm39) V984I possibly damaging Het
Nedd4l G A 18: 65,342,790 (GRCm39) V909I possibly damaging Het
Or10al5 T A 17: 38,063,271 (GRCm39) C175* probably null Het
Or5d47 A T 2: 87,804,066 (GRCm39) N314K probably benign Het
Or7a35 T C 10: 78,854,022 (GRCm39) F289L probably damaging Het
Ovch2 A T 7: 107,394,122 (GRCm39) H110Q probably damaging Het
Pcnx3 G A 19: 5,733,367 (GRCm39) Q155* probably null Het
Pcnx3 C G 19: 5,733,368 (GRCm39) L1F probably null Het
Pi4k2a G A 19: 42,079,131 (GRCm39) R64Q probably damaging Het
Ptpn12 G A 5: 21,203,690 (GRCm39) P363S probably damaging Het
Rbm27 T C 18: 42,425,177 (GRCm39) probably benign Het
Ripor3 A G 2: 167,825,785 (GRCm39) probably benign Het
Rpl13-ps3 A G 14: 59,131,265 (GRCm39) noncoding transcript Het
Sap18b G A 8: 96,552,191 (GRCm39) R67H probably benign Het
Sdhb T C 4: 140,700,311 (GRCm39) V137A probably damaging Het
Shmt2 T C 10: 127,353,897 (GRCm39) T459A probably benign Het
Siglecg A G 7: 43,058,846 (GRCm39) S200G possibly damaging Het
Slc6a15 T G 10: 103,252,646 (GRCm39) I603S probably benign Het
Smtn A T 11: 3,482,865 (GRCm39) probably null Het
Spata31d1a G A 13: 59,851,702 (GRCm39) S142L probably benign Het
Spopfm2 G A 3: 94,082,854 (GRCm39) A319V possibly damaging Het
Spopfm2 C A 3: 94,082,855 (GRCm39) A319S possibly damaging Het
Spopl C T 2: 23,427,392 (GRCm39) R221Q probably damaging Het
Strip1 A G 3: 107,523,135 (GRCm39) V633A probably benign Het
Sun2 A G 15: 79,612,114 (GRCm39) S522P possibly damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Terb2 T A 2: 122,028,913 (GRCm39) C157S probably benign Het
Themis T A 10: 28,739,376 (GRCm39) N615K possibly damaging Het
Tlnrd1 A T 7: 83,531,488 (GRCm39) D314E probably benign Het
Vmn1r205 T A 13: 22,776,566 (GRCm39) T179S probably benign Het
Vsig10l G A 7: 43,118,185 (GRCm39) R689H probably benign Het
Wt1 G A 2: 104,993,773 (GRCm39) probably benign Het
Zfp423 G T 8: 88,507,179 (GRCm39) A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 (GRCm39) E454G possibly damaging Het
Zyg11a G T 4: 108,053,343 (GRCm39) Q440K possibly damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26,149,797 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26,148,943 (GRCm39) nonsense probably null
R4676:Nlrp4a UTSW 7 26,149,654 (GRCm39) missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26,159,236 (GRCm39) critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26,148,690 (GRCm39) missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26,163,571 (GRCm39) missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACACTGGGCTTTTAAGAG -3'
(R):5'- TGTCAAGCCCTCTATGGACTG -3'

Sequencing Primer
(F):5'- GCTTTTAAGAGCCTGTCCTCAAAGG -3'
(R):5'- GTCAAGCCCTCTATGGACTGAACTC -3'
Posted On 2014-10-30