Incidental Mutation 'R2358:Dennd2b'
ID 247015
Institutional Source Beutler Lab
Gene Symbol Dennd2b
Ensembl Gene ENSMUSG00000031024
Gene Name DENN domain containing 2B
Synonyms Denn2b, 2610305K15Rik, St5, 2010004M01Rik
MMRRC Submission 040340-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 109123118-109302812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109155653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 366 (S366T)
Ref Sequence ENSEMBL: ENSMUSP00000078264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]
AlphaFold Q924W7
Predicted Effect probably benign
Transcript: ENSMUST00000077909
AA Change: S366T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: S366T

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079282
AA Change: S366T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: S366T

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084738
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168005
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207394
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208981
Predicted Effect probably benign
Transcript: ENSMUST00000208583
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,215,368 (GRCm39) probably null Het
Aif1l T A 2: 31,859,763 (GRCm39) F94L probably damaging Het
Ankzf1 C T 1: 75,171,895 (GRCm39) H209Y probably damaging Het
Ate1 A T 7: 130,117,895 (GRCm39) M30K probably damaging Het
Cd27 A G 6: 125,210,281 (GRCm39) Y189H probably damaging Het
Cela1 A G 15: 100,579,109 (GRCm39) I183T probably benign Het
Copg2 A T 6: 30,803,168 (GRCm39) L259* probably null Het
Efcab7 T A 4: 99,719,823 (GRCm39) probably benign Het
Fcrl5 A G 3: 87,353,726 (GRCm39) E357G probably damaging Het
Fzr1 C T 10: 81,203,474 (GRCm39) probably null Het
Il12rb2 C T 6: 67,275,179 (GRCm39) A649T probably damaging Het
Itfg1 C A 8: 86,464,758 (GRCm39) V438F probably damaging Het
Jaml A C 9: 45,012,361 (GRCm39) I283L possibly damaging Het
Kif28 A T 1: 179,537,024 (GRCm39) H486Q probably damaging Het
Lrch4 A G 5: 137,636,810 (GRCm39) probably benign Het
Lrfn2 A G 17: 49,378,188 (GRCm39) E423G possibly damaging Het
Lrp4 T A 2: 91,332,299 (GRCm39) N1665K probably benign Het
Mrpl32 A T 13: 14,785,165 (GRCm39) V157E probably damaging Het
Mta3 A G 17: 84,070,417 (GRCm39) I193V probably damaging Het
Myom2 G A 8: 15,162,018 (GRCm39) V984I possibly damaging Het
Nedd4l G A 18: 65,342,790 (GRCm39) V909I possibly damaging Het
Nlrp4a A G 7: 26,163,623 (GRCm39) D930G probably benign Het
Or10al5 T A 17: 38,063,271 (GRCm39) C175* probably null Het
Or5d47 A T 2: 87,804,066 (GRCm39) N314K probably benign Het
Or7a35 T C 10: 78,854,022 (GRCm39) F289L probably damaging Het
Ovch2 A T 7: 107,394,122 (GRCm39) H110Q probably damaging Het
Pcnx3 G A 19: 5,733,367 (GRCm39) Q155* probably null Het
Pcnx3 C G 19: 5,733,368 (GRCm39) L1F probably null Het
Pi4k2a G A 19: 42,079,131 (GRCm39) R64Q probably damaging Het
Ptpn12 G A 5: 21,203,690 (GRCm39) P363S probably damaging Het
Rbm27 T C 18: 42,425,177 (GRCm39) probably benign Het
Ripor3 A G 2: 167,825,785 (GRCm39) probably benign Het
Rpl13-ps3 A G 14: 59,131,265 (GRCm39) noncoding transcript Het
Sap18b G A 8: 96,552,191 (GRCm39) R67H probably benign Het
Sdhb T C 4: 140,700,311 (GRCm39) V137A probably damaging Het
Shmt2 T C 10: 127,353,897 (GRCm39) T459A probably benign Het
Siglecg A G 7: 43,058,846 (GRCm39) S200G possibly damaging Het
Slc6a15 T G 10: 103,252,646 (GRCm39) I603S probably benign Het
Smtn A T 11: 3,482,865 (GRCm39) probably null Het
Spata31d1a G A 13: 59,851,702 (GRCm39) S142L probably benign Het
Spopfm2 G A 3: 94,082,854 (GRCm39) A319V possibly damaging Het
Spopfm2 C A 3: 94,082,855 (GRCm39) A319S possibly damaging Het
Spopl C T 2: 23,427,392 (GRCm39) R221Q probably damaging Het
Strip1 A G 3: 107,523,135 (GRCm39) V633A probably benign Het
Sun2 A G 15: 79,612,114 (GRCm39) S522P possibly damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Terb2 T A 2: 122,028,913 (GRCm39) C157S probably benign Het
Themis T A 10: 28,739,376 (GRCm39) N615K possibly damaging Het
Tlnrd1 A T 7: 83,531,488 (GRCm39) D314E probably benign Het
Vmn1r205 T A 13: 22,776,566 (GRCm39) T179S probably benign Het
Vsig10l G A 7: 43,118,185 (GRCm39) R689H probably benign Het
Wt1 G A 2: 104,993,773 (GRCm39) probably benign Het
Zfp423 G T 8: 88,507,179 (GRCm39) A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 (GRCm39) E454G possibly damaging Het
Zyg11a G T 4: 108,053,343 (GRCm39) Q440K possibly damaging Het
Other mutations in Dennd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dennd2b APN 7 109,126,915 (GRCm39) missense possibly damaging 0.71
IGL01132:Dennd2b APN 7 109,169,212 (GRCm39) splice site probably null
IGL01288:Dennd2b APN 7 109,139,029 (GRCm39) missense probably damaging 0.96
IGL01645:Dennd2b APN 7 109,126,841 (GRCm39) nonsense probably null
IGL01714:Dennd2b APN 7 109,169,269 (GRCm39) missense probably damaging 0.99
IGL02021:Dennd2b APN 7 109,156,579 (GRCm39) missense probably damaging 1.00
IGL02302:Dennd2b APN 7 109,124,538 (GRCm39) missense probably damaging 1.00
IGL02496:Dennd2b APN 7 109,155,442 (GRCm39) missense possibly damaging 0.83
IGL02795:Dennd2b APN 7 109,155,571 (GRCm39) missense probably damaging 1.00
Bucolic UTSW 7 109,124,755 (GRCm39) nonsense probably null
Halcyon UTSW 7 109,156,000 (GRCm39) nonsense probably null
FR4340:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
FR4737:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
PIT4466001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4469001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4472001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
R0024:Dennd2b UTSW 7 109,123,866 (GRCm39) missense probably damaging 1.00
R0124:Dennd2b UTSW 7 109,141,718 (GRCm39) missense possibly damaging 0.66
R0125:Dennd2b UTSW 7 109,155,545 (GRCm39) missense probably benign 0.19
R0365:Dennd2b UTSW 7 109,138,156 (GRCm39) missense probably damaging 1.00
R0491:Dennd2b UTSW 7 109,156,411 (GRCm39) missense probably benign 0.45
R0534:Dennd2b UTSW 7 109,140,635 (GRCm39) missense probably damaging 1.00
R0662:Dennd2b UTSW 7 109,156,633 (GRCm39) missense probably damaging 1.00
R0743:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R0772:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0774:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0787:Dennd2b UTSW 7 109,124,827 (GRCm39) missense possibly damaging 0.94
R0884:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R1518:Dennd2b UTSW 7 109,156,562 (GRCm39) missense probably damaging 1.00
R1908:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R1909:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R2232:Dennd2b UTSW 7 109,156,414 (GRCm39) missense probably benign
R2847:Dennd2b UTSW 7 109,124,544 (GRCm39) missense probably damaging 1.00
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2873:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2874:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R4534:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4536:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4559:Dennd2b UTSW 7 109,124,785 (GRCm39) missense probably damaging 1.00
R4798:Dennd2b UTSW 7 109,156,240 (GRCm39) missense probably damaging 0.99
R4846:Dennd2b UTSW 7 109,156,043 (GRCm39) nonsense probably null
R5110:Dennd2b UTSW 7 109,141,697 (GRCm39) missense probably benign 0.02
R5181:Dennd2b UTSW 7 109,155,997 (GRCm39) missense probably benign
R5268:Dennd2b UTSW 7 109,156,519 (GRCm39) missense probably benign
R5403:Dennd2b UTSW 7 109,156,112 (GRCm39) missense probably damaging 1.00
R5836:Dennd2b UTSW 7 109,140,552 (GRCm39) missense possibly damaging 0.78
R5932:Dennd2b UTSW 7 109,169,223 (GRCm39) missense probably damaging 1.00
R5937:Dennd2b UTSW 7 109,156,478 (GRCm39) missense possibly damaging 0.86
R6180:Dennd2b UTSW 7 109,156,095 (GRCm39) missense probably benign 0.11
R6741:Dennd2b UTSW 7 109,144,304 (GRCm39) missense possibly damaging 0.95
R6781:Dennd2b UTSW 7 109,124,511 (GRCm39) missense possibly damaging 0.83
R7086:Dennd2b UTSW 7 109,124,781 (GRCm39) missense probably damaging 1.00
R7466:Dennd2b UTSW 7 109,124,553 (GRCm39) missense probably damaging 1.00
R7644:Dennd2b UTSW 7 109,156,000 (GRCm39) nonsense probably null
R8354:Dennd2b UTSW 7 109,124,755 (GRCm39) nonsense probably null
R8745:Dennd2b UTSW 7 109,156,279 (GRCm39) missense probably benign 0.02
R8859:Dennd2b UTSW 7 109,123,863 (GRCm39) missense probably damaging 1.00
R9016:Dennd2b UTSW 7 109,139,642 (GRCm39) missense possibly damaging 0.84
R9178:Dennd2b UTSW 7 109,156,291 (GRCm39) missense probably benign 0.31
R9361:Dennd2b UTSW 7 109,126,991 (GRCm39) missense probably damaging 1.00
R9564:Dennd2b UTSW 7 109,125,536 (GRCm39) missense probably damaging 1.00
R9595:Dennd2b UTSW 7 109,155,973 (GRCm39) missense probably damaging 0.96
RF062:Dennd2b UTSW 7 109,156,153 (GRCm39) unclassified probably benign
X0067:Dennd2b UTSW 7 109,155,447 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGCATGTCCTTCTTGGGTC -3'
(R):5'- CTGCTACAGTGTAGACCAAGGG -3'

Sequencing Primer
(F):5'- ATGTCCTTCTTGGGTCTCCGG -3'
(R):5'- CTACAGTGTAGACCAAGGGAGGAG -3'
Posted On 2014-10-30