Mutagenetix > Incidental Mutation

Incidental Mutation 'R2358:Itfg1'

247018

Institutional Source

Beutler Lab

Gene Symbol

Itfg1

Ensembl Gene

ENSMUSG00000031703

Gene Name

integrin alpha FG-GAP repeat containing 1

Synonyms

D8Wsu49e, 2310047C21Rik

MMRRC Submission

040340-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R2358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85717578-85840921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85738129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 438 (V438F)

Ref Sequence

ENSEMBL: ENSMUSP00000034140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034140]

AlphaFold

Q99KW9

Predicted Effect

probably damaging
Transcript: ENSMUST00000034140
AA Change: V438F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: V438F

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
SCOP:d1m1xa4	46	232	5e-3	SMART
low complexity region	482	496	N/A	INTRINSIC
transmembrane domain	564	586	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210572

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210912

Meta Mutation Damage Score

0.7350

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,077,305		probably null	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Ankzf1	C	T	1: 75,195,251	H209Y	probably damaging	Het
Ate1	A	T	7: 130,516,165	M30K	probably damaging	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Cela1	A	G	15: 100,681,228	I183T	probably benign	Het
Copg2	A	T	6: 30,826,233	L259*	probably null	Het
Efcab7	T	A	4: 99,831,586		probably benign	Het
Fcrl5	A	G	3: 87,446,419	E357G	probably damaging	Het
Fzr1	C	T	10: 81,367,640		probably null	Het
Gm10696	G	A	3: 94,175,547	A319V	possibly damaging	Het
Gm10696	C	A	3: 94,175,548	A319S	possibly damaging	Het
Il12rb2	C	T	6: 67,298,195	A649T	probably damaging	Het
Jaml	A	C	9: 45,101,063	I283L	possibly damaging	Het
Kif28	A	T	1: 179,709,459	H486Q	probably damaging	Het
Lrch4	A	G	5: 137,638,548		probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mrpl32	A	T	13: 14,610,580	V157E	probably damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Myom2	G	A	8: 15,112,018	V984I	possibly damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nlrp4a	A	G	7: 26,464,198	D930G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr1351	T	C	10: 79,018,188	F289L	probably damaging	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Ovch2	A	T	7: 107,794,915	H110Q	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Pi4k2a	G	A	19: 42,090,692	R64Q	probably damaging	Het
Ptpn12	G	A	5: 20,998,692	P363S	probably damaging	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Ripor3	A	G	2: 167,983,865		probably benign	Het
Rpl13-ps3	A	G	14: 58,893,816		noncoding transcript	Het
Sap18b	G	A	8: 95,825,563	R67H	probably benign	Het
Sdhb	T	C	4: 140,973,000	V137A	probably damaging	Het
Shmt2	T	C	10: 127,518,028	T459A	probably benign	Het
Siglecg	A	G	7: 43,409,422	S200G	possibly damaging	Het
Slc6a15	T	G	10: 103,416,785	I603S	probably benign	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Spata31d1a	G	A	13: 59,703,888	S142L	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
St5	A	T	7: 109,556,446	S366T	probably benign	Het
Strip1	A	G	3: 107,615,819	V633A	probably benign	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Terb2	T	A	2: 122,198,432	C157S	probably benign	Het
Themis	T	A	10: 28,863,380	N615K	possibly damaging	Het
Tlnrd1	A	T	7: 83,882,280	D314E	probably benign	Het
Vmn1r205	T	A	13: 22,592,396	T179S	probably benign	Het
Vsig10l	G	A	7: 43,468,761	R689H	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Zfp423	G	T	8: 87,780,551	A1034D	possibly damaging	Het
Zfy2	T	C	Y: 2,107,272	E454G	possibly damaging	Het
Zyg11a	G	T	4: 108,196,146	Q440K	possibly damaging	Het

Other mutations in Itfg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02579:Itfg1	APN	8	85780565	missense	possibly damaging	0.95
IGL02803:Itfg1	APN	8	85725511	splice site	probably null
R0368:Itfg1	UTSW	8	85764407	missense	probably damaging	1.00
R0755:Itfg1	UTSW	8	85726205	missense	possibly damaging	0.90
R1183:Itfg1	UTSW	8	85780523	missense	probably benign	0.04
R1529:Itfg1	UTSW	8	85810614	missense	probably benign	0.02
R1789:Itfg1	UTSW	8	85725512	critical splice donor site	probably null
R1953:Itfg1	UTSW	8	85831231	missense	probably benign	0.31
R2206:Itfg1	UTSW	8	85776198	missense	probably benign	0.17
R2207:Itfg1	UTSW	8	85776198	missense	probably benign	0.17
R2260:Itfg1	UTSW	8	85722677	missense	probably damaging	1.00
R2876:Itfg1	UTSW	8	85780510	splice site	probably benign
R2990:Itfg1	UTSW	8	85835049	missense	possibly damaging	0.82
R4484:Itfg1	UTSW	8	85726249	missense	probably damaging	1.00
R4762:Itfg1	UTSW	8	85732441	missense	possibly damaging	0.95
R5146:Itfg1	UTSW	8	85718868	makesense	probably null
R5796:Itfg1	UTSW	8	85718893	missense	probably damaging	1.00
R5805:Itfg1	UTSW	8	85766972	missense	probably benign	0.04
R6084:Itfg1	UTSW	8	85726170	missense	probably benign	0.01
R6187:Itfg1	UTSW	8	85836465	missense	probably damaging	1.00
R6319:Itfg1	UTSW	8	85840629	missense	probably damaging	1.00
R6463:Itfg1	UTSW	8	85736151	missense	probably benign	0.03
R6490:Itfg1	UTSW	8	85740301	missense	probably benign	0.08
R6492:Itfg1	UTSW	8	85740349	missense	probably benign	0.14
R6588:Itfg1	UTSW	8	85736130	missense	probably benign
R6753:Itfg1	UTSW	8	85835078	missense	probably benign	0.04
R7489:Itfg1	UTSW	8	85767001	missense	probably damaging	1.00
R7665:Itfg1	UTSW	8	85764350	missense	probably benign
R7912:Itfg1	UTSW	8	85764280	missense	probably damaging	1.00
R7985:Itfg1	UTSW	8	85725568	missense	probably damaging	1.00
R8927:Itfg1	UTSW	8	85840791	unclassified	probably benign
R8928:Itfg1	UTSW	8	85840791	unclassified	probably benign
R9080:Itfg1	UTSW	8	85740245	missense	possibly damaging	0.82
R9456:Itfg1	UTSW	8	85838937	missense	probably benign	0.01
R9513:Itfg1	UTSW	8	85764246	missense	possibly damaging	0.92
R9577:Itfg1	UTSW	8	85776169	missense	probably benign	0.01
R9761:Itfg1	UTSW	8	85836402	missense	probably benign	0.00
X0067:Itfg1	UTSW	8	85840753	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCCTCACTGTGCAAGTTTG -3'
(R):5'- TGGGGTAACAGAGCACACAC -3'

Sequencing Primer
(F):5'- TTCAACCGATATCCTGGGCAG -3'
(R):5'- CTACAGCACAAGTCACATGGTGTTC -3'

Posted On

2014-10-30