Incidental Mutation 'R2358:Fzr1'
ID 247024
Institutional Source Beutler Lab
Gene Symbol Fzr1
Ensembl Gene ENSMUSG00000020235
Gene Name fizzy and cell division cycle 20 related 1
Synonyms Fyr, Cdh1
MMRRC Submission 040340-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 81202713-81214204 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 81203474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020456] [ENSMUST00000020457] [ENSMUST00000044844] [ENSMUST00000118812] [ENSMUST00000118812] [ENSMUST00000140901] [ENSMUST00000140901]
AlphaFold Q9R1K5
Predicted Effect probably benign
Transcript: ENSMUST00000020456
SMART Domains Protein: ENSMUSP00000020456
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 23 204 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020457
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044844
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130762
Predicted Effect probably null
Transcript: ENSMUST00000140901
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140901
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150824
Predicted Effect probably benign
Transcript: ENSMUST00000131736
SMART Domains Protein: ENSMUSP00000123068
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 1 128 2.6e-47 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Homozygous null mutants die embryonically at around E9.5-E12.5 with poorly developed placentae, no placental giant cells and/or erythroblast deficiency. Homozygous MEFs undergo premature senescence. Heterozygotes exhibit learning/memory defects and/or elevatedspontaneous epithelial tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,215,368 (GRCm39) probably null Het
Aif1l T A 2: 31,859,763 (GRCm39) F94L probably damaging Het
Ankzf1 C T 1: 75,171,895 (GRCm39) H209Y probably damaging Het
Ate1 A T 7: 130,117,895 (GRCm39) M30K probably damaging Het
Cd27 A G 6: 125,210,281 (GRCm39) Y189H probably damaging Het
Cela1 A G 15: 100,579,109 (GRCm39) I183T probably benign Het
Copg2 A T 6: 30,803,168 (GRCm39) L259* probably null Het
Dennd2b A T 7: 109,155,653 (GRCm39) S366T probably benign Het
Efcab7 T A 4: 99,719,823 (GRCm39) probably benign Het
Fcrl5 A G 3: 87,353,726 (GRCm39) E357G probably damaging Het
Il12rb2 C T 6: 67,275,179 (GRCm39) A649T probably damaging Het
Itfg1 C A 8: 86,464,758 (GRCm39) V438F probably damaging Het
Jaml A C 9: 45,012,361 (GRCm39) I283L possibly damaging Het
Kif28 A T 1: 179,537,024 (GRCm39) H486Q probably damaging Het
Lrch4 A G 5: 137,636,810 (GRCm39) probably benign Het
Lrfn2 A G 17: 49,378,188 (GRCm39) E423G possibly damaging Het
Lrp4 T A 2: 91,332,299 (GRCm39) N1665K probably benign Het
Mrpl32 A T 13: 14,785,165 (GRCm39) V157E probably damaging Het
Mta3 A G 17: 84,070,417 (GRCm39) I193V probably damaging Het
Myom2 G A 8: 15,162,018 (GRCm39) V984I possibly damaging Het
Nedd4l G A 18: 65,342,790 (GRCm39) V909I possibly damaging Het
Nlrp4a A G 7: 26,163,623 (GRCm39) D930G probably benign Het
Or10al5 T A 17: 38,063,271 (GRCm39) C175* probably null Het
Or5d47 A T 2: 87,804,066 (GRCm39) N314K probably benign Het
Or7a35 T C 10: 78,854,022 (GRCm39) F289L probably damaging Het
Ovch2 A T 7: 107,394,122 (GRCm39) H110Q probably damaging Het
Pcnx3 G A 19: 5,733,367 (GRCm39) Q155* probably null Het
Pcnx3 C G 19: 5,733,368 (GRCm39) L1F probably null Het
Pi4k2a G A 19: 42,079,131 (GRCm39) R64Q probably damaging Het
Ptpn12 G A 5: 21,203,690 (GRCm39) P363S probably damaging Het
Rbm27 T C 18: 42,425,177 (GRCm39) probably benign Het
Ripor3 A G 2: 167,825,785 (GRCm39) probably benign Het
Rpl13-ps3 A G 14: 59,131,265 (GRCm39) noncoding transcript Het
Sap18b G A 8: 96,552,191 (GRCm39) R67H probably benign Het
Sdhb T C 4: 140,700,311 (GRCm39) V137A probably damaging Het
Shmt2 T C 10: 127,353,897 (GRCm39) T459A probably benign Het
Siglecg A G 7: 43,058,846 (GRCm39) S200G possibly damaging Het
Slc6a15 T G 10: 103,252,646 (GRCm39) I603S probably benign Het
Smtn A T 11: 3,482,865 (GRCm39) probably null Het
Spata31d1a G A 13: 59,851,702 (GRCm39) S142L probably benign Het
Spopfm2 G A 3: 94,082,854 (GRCm39) A319V possibly damaging Het
Spopfm2 C A 3: 94,082,855 (GRCm39) A319S possibly damaging Het
Spopl C T 2: 23,427,392 (GRCm39) R221Q probably damaging Het
Strip1 A G 3: 107,523,135 (GRCm39) V633A probably benign Het
Sun2 A G 15: 79,612,114 (GRCm39) S522P possibly damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Terb2 T A 2: 122,028,913 (GRCm39) C157S probably benign Het
Themis T A 10: 28,739,376 (GRCm39) N615K possibly damaging Het
Tlnrd1 A T 7: 83,531,488 (GRCm39) D314E probably benign Het
Vmn1r205 T A 13: 22,776,566 (GRCm39) T179S probably benign Het
Vsig10l G A 7: 43,118,185 (GRCm39) R689H probably benign Het
Wt1 G A 2: 104,993,773 (GRCm39) probably benign Het
Zfp423 G T 8: 88,507,179 (GRCm39) A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 (GRCm39) E454G possibly damaging Het
Zyg11a G T 4: 108,053,343 (GRCm39) Q440K possibly damaging Het
Other mutations in Fzr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Fzr1 APN 10 81,206,359 (GRCm39) nonsense probably null
IGL02541:Fzr1 APN 10 81,205,867 (GRCm39) missense probably damaging 0.98
IGL03327:Fzr1 APN 10 81,205,018 (GRCm39) missense probably benign 0.05
IGL03346:Fzr1 APN 10 81,205,018 (GRCm39) missense probably benign 0.05
PIT4445001:Fzr1 UTSW 10 81,205,228 (GRCm39) nonsense probably null
R0179:Fzr1 UTSW 10 81,204,904 (GRCm39) splice site probably benign
R0403:Fzr1 UTSW 10 81,205,202 (GRCm39) missense possibly damaging 0.95
R1591:Fzr1 UTSW 10 81,206,201 (GRCm39) missense possibly damaging 0.75
R1987:Fzr1 UTSW 10 81,206,153 (GRCm39) missense probably damaging 0.98
R2844:Fzr1 UTSW 10 81,205,252 (GRCm39) missense probably damaging 1.00
R4657:Fzr1 UTSW 10 81,203,386 (GRCm39) critical splice acceptor site probably null
R5054:Fzr1 UTSW 10 81,207,253 (GRCm39) utr 5 prime probably benign
R5108:Fzr1 UTSW 10 81,205,284 (GRCm39) splice site probably benign
R5201:Fzr1 UTSW 10 81,203,362 (GRCm39) missense probably damaging 1.00
R5494:Fzr1 UTSW 10 81,207,178 (GRCm39) critical splice donor site probably null
R5663:Fzr1 UTSW 10 81,206,360 (GRCm39) missense probably benign 0.00
R5733:Fzr1 UTSW 10 81,206,160 (GRCm39) missense possibly damaging 0.95
R5997:Fzr1 UTSW 10 81,206,660 (GRCm39) critical splice acceptor site probably null
R6777:Fzr1 UTSW 10 81,206,327 (GRCm39) missense probably damaging 1.00
R7055:Fzr1 UTSW 10 81,206,057 (GRCm39) missense probably damaging 1.00
R7078:Fzr1 UTSW 10 81,204,463 (GRCm39) missense probably damaging 1.00
R7883:Fzr1 UTSW 10 81,204,469 (GRCm39) missense probably damaging 1.00
R8374:Fzr1 UTSW 10 81,203,368 (GRCm39) missense probably damaging 1.00
R8428:Fzr1 UTSW 10 81,206,942 (GRCm39) missense probably damaging 0.99
R9149:Fzr1 UTSW 10 81,205,249 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGCATTTAATGAGACTCTGGGG -3'
(R):5'- TAGCCCAGAATCCATGTCCC -3'

Sequencing Primer
(F):5'- AGCAAGGCCTATGCATGC -3'
(R):5'- AGAATCCATGTCCCCTGGC -3'
Posted On 2014-10-30