Incidental Mutation 'R2358:Nedd4l'
ID 247043
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 040340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R2358 (G1)
Quality Score 203
Status Validated
Chromosome 18
Chromosomal Location 64887705-65217831 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65209719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 909 (V909I)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080418
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: V788I

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163516
AA Change: V909I

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V909I

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224347
AA Change: V768I

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably benign
Transcript: ENSMUST00000226058
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1459 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Ptpn12 G A 5: 20,998,692 P363S probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Sdhb T C 4: 140,973,000 V137A probably damaging Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense probably benign
R9025:Nedd4l UTSW 18 65178924 missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65209663 missense probably damaging 0.99
R9482:Nedd4l UTSW 18 64887960 unclassified probably benign
R9498:Nedd4l UTSW 18 65161652 critical splice donor site probably null
R9599:Nedd4l UTSW 18 65210329 missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAAAGGCTGGGATTGTAGC -3'
(R):5'- GAAGCCCTCTGTTCTGCATC -3'

Sequencing Primer
(F):5'- AGACAATGCCGGTCTTGG -3'
(R):5'- CTCCGTGGGTCTCTGTGGAAC -3'
Posted On 2014-10-30