Incidental Mutation 'R2358:Pcnx3'
ID247044
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 040340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2358 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 5683339 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 155 (Q155*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]
Predicted Effect probably null
Transcript: ENSMUST00000068169
AA Change: Q317*
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: Q317*

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113615
AA Change: Q725*
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: Q725*

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127876
AA Change: Q2*
SMART Domains Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874
AA Change: Q2*

DomainStartEndE-ValueType
low complexity region 69 75 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Predicted Effect probably benign
Transcript: ENSMUST00000137313
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141577
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 104 110 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 207 224 N/A INTRINSIC
transmembrane domain 229 251 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145270
AA Change: Q155*
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874
AA Change: Q155*

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184789
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Ptpn12 G A 5: 20,998,692 P363S probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Sdhb T C 4: 140,973,000 V137A probably damaging Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
buns UTSW 19 5683340 start codon destroyed probably null
Pastries UTSW 19 5683339 nonsense probably null
Pecan UTSW 19 5672615 missense probably damaging 1.00
pie UTSW 19 5667158 missense possibly damaging 0.81
swirls UTSW 19 5672515 missense probably damaging 1.00
tip UTSW 19 5683780 splice site probably benign
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
R7177:Pcnx3 UTSW 19 5687499 missense probably benign 0.01
R7308:Pcnx3 UTSW 19 5686147 missense possibly damaging 0.52
R7387:Pcnx3 UTSW 19 5673336 missense probably benign 0.33
R7488:Pcnx3 UTSW 19 5667459 missense possibly damaging 0.72
R7670:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAGTGATCTAGCCCTCTTGG -3'
(R):5'- GGCCTGCAAGAGATACTTCTG -3'

Sequencing Primer
(F):5'- ACCAGCCTTAGTCATCTG -3'
(R):5'- CCTGCAAGAGATACTTCTGCAATCTG -3'
Posted On2014-10-30