Mutagenetix > Incidental Mutation

Incidental Mutation 'R2358:Pi4k2a'

247046

Institutional Source

Beutler Lab

Gene Symbol

Pi4k2a

Ensembl Gene

ENSMUSG00000025178

Gene Name

phosphatidylinositol 4-kinase type 2 alpha

Synonyms

MMRRC Submission

040340-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R2358 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

42090435-42122218 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42090692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 64 (R64Q)

Ref Sequence

ENSEMBL: ENSMUSP00000069284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051772] [ENSMUST00000066778]

AlphaFold

Q2TBE6

Predicted Effect

probably benign
Transcript: ENSMUST00000051772

SMART Domains

Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

Domain	Start	End	E-Value	Type
MORN	14	35	1.64e-5	SMART
MORN	37	58	4.15e-2	SMART
MORN	60	81	1.86e-4	SMART
MORN	83	104	1.84e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000066778
AA Change: R64Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: R64Q

Domain	Start	End	E-Value	Type
low complexity region	31	53	N/A	INTRINSIC
low complexity region	68	98	N/A	INTRINSIC
Pfam:PI3_PI4_kinase	133	431	1.7e-67	PFAM

Meta Mutation Damage Score

0.2657

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,077,305		probably null	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Ankzf1	C	T	1: 75,195,251	H209Y	probably damaging	Het
Ate1	A	T	7: 130,516,165	M30K	probably damaging	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Cela1	A	G	15: 100,681,228	I183T	probably benign	Het
Copg2	A	T	6: 30,826,233	L259*	probably null	Het
Efcab7	T	A	4: 99,831,586		probably benign	Het
Fcrl5	A	G	3: 87,446,419	E357G	probably damaging	Het
Fzr1	C	T	10: 81,367,640		probably null	Het
Gm10696	G	A	3: 94,175,547	A319V	possibly damaging	Het
Gm10696	C	A	3: 94,175,548	A319S	possibly damaging	Het
Il12rb2	C	T	6: 67,298,195	A649T	probably damaging	Het
Itfg1	C	A	8: 85,738,129	V438F	probably damaging	Het
Jaml	A	C	9: 45,101,063	I283L	possibly damaging	Het
Kif28	A	T	1: 179,709,459	H486Q	probably damaging	Het
Lrch4	A	G	5: 137,638,548		probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mrpl32	A	T	13: 14,610,580	V157E	probably damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Myom2	G	A	8: 15,112,018	V984I	possibly damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nlrp4a	A	G	7: 26,464,198	D930G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr1351	T	C	10: 79,018,188	F289L	probably damaging	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Ovch2	A	T	7: 107,794,915	H110Q	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Ptpn12	G	A	5: 20,998,692	P363S	probably damaging	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Ripor3	A	G	2: 167,983,865		probably benign	Het
Rpl13-ps3	A	G	14: 58,893,816		noncoding transcript	Het
Sap18b	G	A	8: 95,825,563	R67H	probably benign	Het
Sdhb	T	C	4: 140,973,000	V137A	probably damaging	Het
Shmt2	T	C	10: 127,518,028	T459A	probably benign	Het
Siglecg	A	G	7: 43,409,422	S200G	possibly damaging	Het
Slc6a15	T	G	10: 103,416,785	I603S	probably benign	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Spata31d1a	G	A	13: 59,703,888	S142L	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
St5	A	T	7: 109,556,446	S366T	probably benign	Het
Strip1	A	G	3: 107,615,819	V633A	probably benign	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Terb2	T	A	2: 122,198,432	C157S	probably benign	Het
Themis	T	A	10: 28,863,380	N615K	possibly damaging	Het
Tlnrd1	A	T	7: 83,882,280	D314E	probably benign	Het
Vmn1r205	T	A	13: 22,592,396	T179S	probably benign	Het
Vsig10l	G	A	7: 43,468,761	R689H	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Zfp423	G	T	8: 87,780,551	A1034D	possibly damaging	Het
Zfy2	T	C	Y: 2,107,272	E454G	possibly damaging	Het
Zyg11a	G	T	4: 108,196,146	Q440K	possibly damaging	Het

Other mutations in Pi4k2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01710:Pi4k2a	APN	19	42104979	missense	probably damaging	1.00
IGL02959:Pi4k2a	APN	19	42113071	missense	probably benign	0.42
R1570:Pi4k2a	UTSW	19	42100644	missense	probably benign	0.33
R1992:Pi4k2a	UTSW	19	42115938	missense	probably damaging	1.00
R2113:Pi4k2a	UTSW	19	42115071	missense	possibly damaging	0.78
R2410:Pi4k2a	UTSW	19	42104877	missense	possibly damaging	0.55
R3547:Pi4k2a	UTSW	19	42090548	missense	probably benign	0.10
R3708:Pi4k2a	UTSW	19	42090931	nonsense	probably null
R3712:Pi4k2a	UTSW	19	42090692	missense	probably damaging	0.99
R3954:Pi4k2a	UTSW	19	42115899	missense	probably damaging	0.98
R4654:Pi4k2a	UTSW	19	42113105	critical splice donor site	probably null
R5077:Pi4k2a	UTSW	19	42119836	splice site	probably null
R5386:Pi4k2a	UTSW	19	42090515	missense	probably damaging	0.99
R5846:Pi4k2a	UTSW	19	42115038	missense	probably benign	0.01
R5867:Pi4k2a	UTSW	19	42105485	critical splice donor site	probably null
R5878:Pi4k2a	UTSW	19	42100641	missense	probably benign	0.02
R6502:Pi4k2a	UTSW	19	42090932	missense	probably benign	0.04
R7042:Pi4k2a	UTSW	19	42104898	missense	probably benign	0.18
R7269:Pi4k2a	UTSW	19	42090686	missense	probably damaging	1.00
R7819:Pi4k2a	UTSW	19	42090574	missense	probably benign
R8249:Pi4k2a	UTSW	19	42115062	missense	probably benign	0.00
R8560:Pi4k2a	UTSW	19	42100712	nonsense	probably null
R9038:Pi4k2a	UTSW	19	42100796	missense	probably damaging	1.00
Z1177:Pi4k2a	UTSW	19	42104925	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGTCGCCAAGTAAACAGGACAG -3'
(R):5'- TAGATGCTGCACTCGATGGC -3'

Sequencing Primer
(F):5'- AGACGAGCCCGCTAGTGTC -3'
(R):5'- TGCACTCGATGGCAACCTC -3'

Posted On

2014-10-30