Incidental Mutation 'R2358:Tectb'
ID 247047
Institutional Source Beutler Lab
Gene Symbol Tectb
Ensembl Gene ENSMUSG00000024979
Gene Name tectorin beta
Synonyms Tctnb, [b]-tectorin
MMRRC Submission 040340-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2358 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 55169165-55184745 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) C to G at 55169431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025936] [ENSMUST00000120936] [ENSMUST00000154886]
AlphaFold O08524
Predicted Effect probably benign
Transcript: ENSMUST00000025936
SMART Domains Protein: ENSMUSP00000025936
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 283 3.47e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120936
SMART Domains Protein: ENSMUSP00000113805
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 293 1.9e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154886
SMART Domains Protein: ENSMUSP00000121767
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 196 6.19e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-collagenous glycoprotein component of the tectorial membrane, which covers the auditory hair cells in the cochlea of the inner ear. A similar protein in mouse functions in low-frequency hearing. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null allele show an enlarged tectorial membrane with a disrupted striated-sheet matrix, absence of the marginal band, and low-frequency hearing loss. However, basilar-membrane and neural tuning are both enhanced in high-frequency cochlear regions, with little loss in sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,215,368 (GRCm39) probably null Het
Aif1l T A 2: 31,859,763 (GRCm39) F94L probably damaging Het
Ankzf1 C T 1: 75,171,895 (GRCm39) H209Y probably damaging Het
Ate1 A T 7: 130,117,895 (GRCm39) M30K probably damaging Het
Cd27 A G 6: 125,210,281 (GRCm39) Y189H probably damaging Het
Cela1 A G 15: 100,579,109 (GRCm39) I183T probably benign Het
Copg2 A T 6: 30,803,168 (GRCm39) L259* probably null Het
Dennd2b A T 7: 109,155,653 (GRCm39) S366T probably benign Het
Efcab7 T A 4: 99,719,823 (GRCm39) probably benign Het
Fcrl5 A G 3: 87,353,726 (GRCm39) E357G probably damaging Het
Fzr1 C T 10: 81,203,474 (GRCm39) probably null Het
Il12rb2 C T 6: 67,275,179 (GRCm39) A649T probably damaging Het
Itfg1 C A 8: 86,464,758 (GRCm39) V438F probably damaging Het
Jaml A C 9: 45,012,361 (GRCm39) I283L possibly damaging Het
Kif28 A T 1: 179,537,024 (GRCm39) H486Q probably damaging Het
Lrch4 A G 5: 137,636,810 (GRCm39) probably benign Het
Lrfn2 A G 17: 49,378,188 (GRCm39) E423G possibly damaging Het
Lrp4 T A 2: 91,332,299 (GRCm39) N1665K probably benign Het
Mrpl32 A T 13: 14,785,165 (GRCm39) V157E probably damaging Het
Mta3 A G 17: 84,070,417 (GRCm39) I193V probably damaging Het
Myom2 G A 8: 15,162,018 (GRCm39) V984I possibly damaging Het
Nedd4l G A 18: 65,342,790 (GRCm39) V909I possibly damaging Het
Nlrp4a A G 7: 26,163,623 (GRCm39) D930G probably benign Het
Or10al5 T A 17: 38,063,271 (GRCm39) C175* probably null Het
Or5d47 A T 2: 87,804,066 (GRCm39) N314K probably benign Het
Or7a35 T C 10: 78,854,022 (GRCm39) F289L probably damaging Het
Ovch2 A T 7: 107,394,122 (GRCm39) H110Q probably damaging Het
Pcnx3 G A 19: 5,733,367 (GRCm39) Q155* probably null Het
Pcnx3 C G 19: 5,733,368 (GRCm39) L1F probably null Het
Pi4k2a G A 19: 42,079,131 (GRCm39) R64Q probably damaging Het
Ptpn12 G A 5: 21,203,690 (GRCm39) P363S probably damaging Het
Rbm27 T C 18: 42,425,177 (GRCm39) probably benign Het
Ripor3 A G 2: 167,825,785 (GRCm39) probably benign Het
Rpl13-ps3 A G 14: 59,131,265 (GRCm39) noncoding transcript Het
Sap18b G A 8: 96,552,191 (GRCm39) R67H probably benign Het
Sdhb T C 4: 140,700,311 (GRCm39) V137A probably damaging Het
Shmt2 T C 10: 127,353,897 (GRCm39) T459A probably benign Het
Siglecg A G 7: 43,058,846 (GRCm39) S200G possibly damaging Het
Slc6a15 T G 10: 103,252,646 (GRCm39) I603S probably benign Het
Smtn A T 11: 3,482,865 (GRCm39) probably null Het
Spata31d1a G A 13: 59,851,702 (GRCm39) S142L probably benign Het
Spopfm2 G A 3: 94,082,854 (GRCm39) A319V possibly damaging Het
Spopfm2 C A 3: 94,082,855 (GRCm39) A319S possibly damaging Het
Spopl C T 2: 23,427,392 (GRCm39) R221Q probably damaging Het
Strip1 A G 3: 107,523,135 (GRCm39) V633A probably benign Het
Sun2 A G 15: 79,612,114 (GRCm39) S522P possibly damaging Het
Terb2 T A 2: 122,028,913 (GRCm39) C157S probably benign Het
Themis T A 10: 28,739,376 (GRCm39) N615K possibly damaging Het
Tlnrd1 A T 7: 83,531,488 (GRCm39) D314E probably benign Het
Vmn1r205 T A 13: 22,776,566 (GRCm39) T179S probably benign Het
Vsig10l G A 7: 43,118,185 (GRCm39) R689H probably benign Het
Wt1 G A 2: 104,993,773 (GRCm39) probably benign Het
Zfp423 G T 8: 88,507,179 (GRCm39) A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 (GRCm39) E454G possibly damaging Het
Zyg11a G T 4: 108,053,343 (GRCm39) Q440K possibly damaging Het
Other mutations in Tectb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Tectb APN 19 55,172,445 (GRCm39) missense probably damaging 1.00
IGL02001:Tectb APN 19 55,178,027 (GRCm39) missense possibly damaging 0.48
IGL02510:Tectb APN 19 55,179,943 (GRCm39) missense probably damaging 1.00
BB010:Tectb UTSW 19 55,183,105 (GRCm39) missense possibly damaging 0.87
BB020:Tectb UTSW 19 55,183,105 (GRCm39) missense possibly damaging 0.87
R0028:Tectb UTSW 19 55,183,109 (GRCm39) missense probably benign 0.01
R0130:Tectb UTSW 19 55,170,393 (GRCm39) missense probably damaging 0.99
R0586:Tectb UTSW 19 55,170,356 (GRCm39) missense probably damaging 1.00
R0598:Tectb UTSW 19 55,178,018 (GRCm39) nonsense probably null
R0655:Tectb UTSW 19 55,178,302 (GRCm39) missense possibly damaging 0.78
R0708:Tectb UTSW 19 55,179,984 (GRCm39) missense probably benign 0.37
R1314:Tectb UTSW 19 55,172,417 (GRCm39) missense probably damaging 1.00
R1999:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2000:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2024:Tectb UTSW 19 55,170,361 (GRCm39) missense probably damaging 1.00
R2148:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2159:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2160:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2161:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2162:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2355:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2495:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2497:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2511:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2568:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2570:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2848:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2897:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R2898:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R3712:Tectb UTSW 19 55,169,431 (GRCm39) start gained probably benign
R5671:Tectb UTSW 19 55,181,059 (GRCm39) missense probably benign 0.42
R5875:Tectb UTSW 19 55,178,058 (GRCm39) missense possibly damaging 0.94
R6312:Tectb UTSW 19 55,181,094 (GRCm39) frame shift probably null
R6315:Tectb UTSW 19 55,179,904 (GRCm39) missense possibly damaging 0.73
R6366:Tectb UTSW 19 55,170,350 (GRCm39) missense probably damaging 1.00
R7729:Tectb UTSW 19 55,181,104 (GRCm39) missense
R7933:Tectb UTSW 19 55,183,105 (GRCm39) missense possibly damaging 0.87
R8408:Tectb UTSW 19 55,178,099 (GRCm39) critical splice donor site probably null
R8557:Tectb UTSW 19 55,181,105 (GRCm39) unclassified probably benign
R8835:Tectb UTSW 19 55,172,270 (GRCm39) missense probably benign 0.43
R8918:Tectb UTSW 19 55,180,000 (GRCm39) missense probably damaging 1.00
R8935:Tectb UTSW 19 55,183,132 (GRCm39) missense probably benign
R9239:Tectb UTSW 19 55,181,094 (GRCm39) frame shift probably null
R9345:Tectb UTSW 19 55,183,097 (GRCm39) missense probably benign 0.00
R9467:Tectb UTSW 19 55,181,093 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGCATCACCGAGCTCTCTTG -3'
(R):5'- GGAAAGTCTGATTGGCACTGG -3'

Sequencing Primer
(F):5'- TCACCGAGCTCTCTTGGAAAC -3'
(R):5'- GCACTGGGGACTTCTGTTCC -3'
Posted On 2014-10-30