Mutagenetix > Incidental Mutations

Incidental Mutation 'R2359:Arfgef2'

247054

Institutional Source

Beutler Lab

Gene Symbol

Arfgef2

Ensembl Gene

ENSMUSG00000074582

Gene Name

ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)

Synonyms

E230011G24Rik, BIG2

MMRRC Submission

040341-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.317) question?

Stock #

R2359 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166805588-166898052 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 166860619 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 826 (Y826F)

Ref Sequence

ENSEMBL: ENSMUSP00000096677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099078]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099078
AA Change: Y826F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: Y826F

Domain	Start	End	E-Value	Type
Pfam:DCB	7	200	1.6e-40	PFAM
Pfam:Sec7_N	377	536	3.7e-53	PFAM
Blast:Sec7	549	598	8e-18	BLAST
low complexity region	621	633	N/A	INTRINSIC
Sec7	647	834	1.55e-97	SMART
Blast:Sec7	853	888	2e-11	BLAST
Blast:Sec7	902	941	4e-15	BLAST
low complexity region	1044	1055	N/A	INTRINSIC
Pfam:DUF1981	1174	1257	6e-38	PFAM
low complexity region	1719	1729	N/A	INTRINSIC

Meta Mutation Damage Score

0.3527

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,312,651	C12S	probably benign	Het
Adam24	A	G	8: 40,680,945	E484G	possibly damaging	Het
Akr1c20	C	T	13: 4,523,277	G13D	probably damaging	Het
Alkbh3	T	C	2: 94,008,113	T38A	probably benign	Het
Anxa9	A	C	3: 95,302,751	L99R	probably damaging	Het
Arid2	G	T	15: 96,361,878	L306F	probably damaging	Het
Ccdc141	C	T	2: 77,170,402	V29M	probably damaging	Het
Cd55b	A	G	1: 130,418,121	S187P	probably damaging	Het
Cep63	A	C	9: 102,594,564	L526V	possibly damaging	Het
Chtf8	G	T	8: 106,885,416		probably null	Het
Clca4b	T	A	3: 144,925,242	S286C	probably damaging	Het
Cpsf1	A	G	15: 76,597,673	V1080A	probably benign	Het
Csf2rb2	C	T	15: 78,292,776	V165I	probably benign	Het
Cyp2c40	A	T	19: 39,777,954	V399E	probably damaging	Het
Dnmt3a	T	C	12: 3,901,599	S659P	probably damaging	Het
Efr3b	G	A	12: 3,980,136		probably benign	Het
Epha8	A	G	4: 136,946,032	I147T	probably damaging	Het
Fbxo48	G	A	11: 16,953,602	W76*	probably null	Het
Ggt6	A	T	11: 72,437,551	L254F	possibly damaging	Het
Gm11639	T	C	11: 104,739,280	S967P	possibly damaging	Het
Gm4204	T	A	1: 135,232,189		noncoding transcript	Het
Golph3l	A	G	3: 95,591,964		probably null	Het
Gtf2h3	A	G	5: 124,590,876	K166R	probably damaging	Het
Hsp90aa1	A	G	12: 110,694,569		probably null	Het
Hyi	A	G	4: 118,360,341	R79G	probably benign	Het
Igbp1b	G	A	6: 138,657,715	P244S	probably damaging	Het
Ipo8	G	A	6: 148,816,477		probably benign	Het
Larp4b	C	A	13: 9,158,163	T391K	probably damaging	Het
Lrba	T	C	3: 86,348,750	V1133A	probably benign	Het
Med13	C	T	11: 86,291,035		probably benign	Het
Ncapd2	A	G	6: 125,179,416		probably benign	Het
Neurl1b	T	C	17: 26,441,595	F299L	probably benign	Het
Nosip	G	A	7: 45,074,026	A39T	possibly damaging	Het
Nsd1	A	G	13: 55,213,711	D164G	possibly damaging	Het
Ntn1	G	A	11: 68,385,612	T170M	probably damaging	Het
Polrmt	A	T	10: 79,736,562	L1079Q	probably damaging	Het
Rab30	A	G	7: 92,835,797	D129G	possibly damaging	Het
Rwdd2b	C	T	16: 87,436,921	S97N	probably benign	Het
Slitrk3	T	G	3: 73,049,345	D698A	possibly damaging	Het
Smarcd2	T	C	11: 106,267,164	M93V	probably benign	Het
Tmprss4	A	G	9: 45,185,832	V45A	probably benign	Het
Vmn1r22	A	T	6: 57,900,989	M1K	probably null	Het
Vps13a	A	G	19: 16,652,679		probably benign	Het

Other mutations in Arfgef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Arfgef2	APN	2	166885853	missense	probably damaging	1.00
IGL01323:Arfgef2	APN	2	166871495	missense	probably damaging	1.00
IGL01415:Arfgef2	APN	2	166867355	missense	probably damaging	0.98
IGL01638:Arfgef2	APN	2	166873945	missense	probably damaging	0.97
IGL02618:Arfgef2	APN	2	166853313	missense	probably damaging	1.00
IGL02899:Arfgef2	APN	2	166869051	splice site	probably benign
IGL03012:Arfgef2	APN	2	166868888	splice site	probably benign
IGL03063:Arfgef2	APN	2	166859782	splice site	probably benign
migrainous	UTSW	2	166834463	frame shift	probably null
Scotomata	UTSW	2	166851279	critical splice donor site	probably null
shimmering	UTSW	2	166826928	missense	probably benign
R0102:Arfgef2	UTSW	2	166845465	missense	probably benign	0.00
R0102:Arfgef2	UTSW	2	166845465	missense	probably benign	0.00
R0116:Arfgef2	UTSW	2	166873683	missense	probably damaging	1.00
R0128:Arfgef2	UTSW	2	166835719	missense	probably damaging	1.00
R0130:Arfgef2	UTSW	2	166835719	missense	probably damaging	1.00
R0208:Arfgef2	UTSW	2	166867422	missense	probably damaging	1.00
R0379:Arfgef2	UTSW	2	166860400	critical splice donor site	probably null
R0945:Arfgef2	UTSW	2	166826969	unclassified	probably benign
R1226:Arfgef2	UTSW	2	166827640	missense	probably damaging	1.00
R1252:Arfgef2	UTSW	2	166859957	missense	probably damaging	1.00
R1695:Arfgef2	UTSW	2	166864712	missense	probably damaging	0.98
R1696:Arfgef2	UTSW	2	166861638	missense	probably damaging	1.00
R1742:Arfgef2	UTSW	2	166866980	missense	probably damaging	1.00
R1935:Arfgef2	UTSW	2	166863603	missense	probably benign	0.28
R1936:Arfgef2	UTSW	2	166863603	missense	probably benign	0.28
R1939:Arfgef2	UTSW	2	166873628	missense	probably damaging	1.00
R2276:Arfgef2	UTSW	2	166865759	missense	probably benign	0.00
R2279:Arfgef2	UTSW	2	166865759	missense	probably benign	0.00
R2349:Arfgef2	UTSW	2	166852028	missense	probably damaging	1.00
R2414:Arfgef2	UTSW	2	166845504	missense	probably benign	0.00
R2519:Arfgef2	UTSW	2	166881244	missense	probably benign	0.03
R2938:Arfgef2	UTSW	2	166894733	missense	probably damaging	1.00
R3696:Arfgef2	UTSW	2	166853300	nonsense	probably null
R4022:Arfgef2	UTSW	2	166873945	missense	probably benign	0.01
R4227:Arfgef2	UTSW	2	166867324	missense	probably damaging	1.00
R4293:Arfgef2	UTSW	2	166890291	missense	probably benign
R4455:Arfgef2	UTSW	2	166894715	missense	probably benign	0.43
R4499:Arfgef2	UTSW	2	166885814	missense	probably damaging	0.99
R4570:Arfgef2	UTSW	2	166856538	missense	probably damaging	0.99
R4888:Arfgef2	UTSW	2	166835613	missense	probably damaging	1.00
R4893:Arfgef2	UTSW	2	166866956	missense	probably benign
R5032:Arfgef2	UTSW	2	166878544	missense	probably benign
R5191:Arfgef2	UTSW	2	166876511	missense	probably damaging	1.00
R5200:Arfgef2	UTSW	2	166860684	missense	probably benign	0.00
R5318:Arfgef2	UTSW	2	166873971	missense	probably damaging	1.00
R5378:Arfgef2	UTSW	2	166873628	missense	probably damaging	1.00
R5537:Arfgef2	UTSW	2	166856593	splice site	probably null
R5866:Arfgef2	UTSW	2	166836257	missense	possibly damaging	0.88
R5878:Arfgef2	UTSW	2	166870217	missense	probably benign	0.41
R5972:Arfgef2	UTSW	2	166891836	missense	probably damaging	1.00
R6147:Arfgef2	UTSW	2	166871495	missense	probably damaging	1.00
R6293:Arfgef2	UTSW	2	166873588	missense	possibly damaging	0.92
R6323:Arfgef2	UTSW	2	166834484	missense	probably damaging	1.00
R6338:Arfgef2	UTSW	2	166845570	missense	probably damaging	1.00
R6538:Arfgef2	UTSW	2	166893621	splice site	probably null
R6726:Arfgef2	UTSW	2	166893620	critical splice donor site	probably null
R7047:Arfgef2	UTSW	2	166851945	splice site	probably null
R7086:Arfgef2	UTSW	2	166876616	missense	probably damaging	1.00
R7108:Arfgef2	UTSW	2	166873608	missense	possibly damaging	0.80
R7155:Arfgef2	UTSW	2	166865813	missense	probably benign	0.19
R7159:Arfgef2	UTSW	2	166826928	missense	probably benign
R7482:Arfgef2	UTSW	2	166851279	critical splice donor site	probably null
R7598:Arfgef2	UTSW	2	166856524	missense	probably benign
R7869:Arfgef2	UTSW	2	166873703	missense	probably damaging	1.00
R8003:Arfgef2	UTSW	2	166853288	missense	probably damaging	1.00
R8092:Arfgef2	UTSW	2	166859834	missense	probably damaging	1.00
R8093:Arfgef2	UTSW	2	166894657	missense	probably benign	0.02
R8110:Arfgef2	UTSW	2	166878544	missense	probably benign	0.01
R8130:Arfgef2	UTSW	2	166836250	missense	possibly damaging	0.81
R8153:Arfgef2	UTSW	2	166834463	frame shift	probably null
R8156:Arfgef2	UTSW	2	166834463	frame shift	probably null
R8411:Arfgef2	UTSW	2	166873983	missense	probably benign	0.15
R8418:Arfgef2	UTSW	2	166856548	missense	probably benign	0.19
X0040:Arfgef2	UTSW	2	166859883	missense	probably damaging	1.00
X0063:Arfgef2	UTSW	2	166891841	missense	probably benign	0.32
Z1088:Arfgef2	UTSW	2	166893595	missense	possibly damaging	0.78
Z1176:Arfgef2	UTSW	2	166894712	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCAGACATGGCTGAATTTG -3'
(R):5'- TCATGTACCCAAAAGGCAGAGG -3'

Sequencing Primer
(F):5'- CAGACATGGCTGAATTTGTTAGGGC -3'
(R):5'- GGGTCAGCTCTGAAATCACGTAC -3'

Posted On

2014-10-30