Mutagenetix > Incidental Mutations

Incidental Mutation 'R2359:Cep63'

247074

Institutional Source

Beutler Lab

Gene Symbol

Cep63

Ensembl Gene

ENSMUSG00000032534

Gene Name

centrosomal protein 63

Synonyms

D9Mgc48e, CD20R, D9Mgc41, ET2

MMRRC Submission

040341-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.624) question?

Stock #

R2359 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102584588-102626534 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 102594564 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 526 (L526V)

Ref Sequence

ENSEMBL: ENSMUSP00000149157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000162655] [ENSMUST00000216281]

Predicted Effect

probably benign
Transcript: ENSMUST00000093791
AA Change: L526V

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534
AA Change: L526V

Domain	Start	End	E-Value	Type
low complexity region	12	25	N/A	INTRINSIC
Pfam:CEP63	76	338	8.1e-112	PFAM
coiled coil region	401	469	N/A	INTRINSIC
coiled coil region	492	591	N/A	INTRINSIC
low complexity region	651	663	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
coiled coil region	730	749	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160512

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162655
AA Change: L468V

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534
AA Change: L468V

Domain	Start	End	E-Value	Type
coiled coil region	72	220	N/A	INTRINSIC
coiled coil region	243	283	N/A	INTRINSIC
coiled coil region	343	411	N/A	INTRINSIC
coiled coil region	434	484	N/A	INTRINSIC
coiled coil region	510	529	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162960

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216281
AA Change: L526V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.0810

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,312,651	C12S	probably benign	Het
Adam24	A	G	8: 40,680,945	E484G	possibly damaging	Het
Akr1c20	C	T	13: 4,523,277	G13D	probably damaging	Het
Alkbh3	T	C	2: 94,008,113	T38A	probably benign	Het
Anxa9	A	C	3: 95,302,751	L99R	probably damaging	Het
Arfgef2	A	T	2: 166,860,619	Y826F	probably damaging	Het
Arid2	G	T	15: 96,361,878	L306F	probably damaging	Het
Ccdc141	C	T	2: 77,170,402	V29M	probably damaging	Het
Cd55b	A	G	1: 130,418,121	S187P	probably damaging	Het
Chtf8	G	T	8: 106,885,416		probably null	Het
Clca4b	T	A	3: 144,925,242	S286C	probably damaging	Het
Cpsf1	A	G	15: 76,597,673	V1080A	probably benign	Het
Csf2rb2	C	T	15: 78,292,776	V165I	probably benign	Het
Cyp2c40	A	T	19: 39,777,954	V399E	probably damaging	Het
Dnmt3a	T	C	12: 3,901,599	S659P	probably damaging	Het
Efr3b	G	A	12: 3,980,136		probably benign	Het
Epha8	A	G	4: 136,946,032	I147T	probably damaging	Het
Fbxo48	G	A	11: 16,953,602	W76*	probably null	Het
Ggt6	A	T	11: 72,437,551	L254F	possibly damaging	Het
Gm11639	T	C	11: 104,739,280	S967P	possibly damaging	Het
Gm4204	T	A	1: 135,232,189		noncoding transcript	Het
Golph3l	A	G	3: 95,591,964		probably null	Het
Gtf2h3	A	G	5: 124,590,876	K166R	probably damaging	Het
Hsp90aa1	A	G	12: 110,694,569		probably null	Het
Hyi	A	G	4: 118,360,341	R79G	probably benign	Het
Igbp1b	G	A	6: 138,657,715	P244S	probably damaging	Het
Ipo8	G	A	6: 148,816,477		probably benign	Het
Larp4b	C	A	13: 9,158,163	T391K	probably damaging	Het
Lrba	T	C	3: 86,348,750	V1133A	probably benign	Het
Med13	C	T	11: 86,291,035		probably benign	Het
Ncapd2	A	G	6: 125,179,416		probably benign	Het
Neurl1b	T	C	17: 26,441,595	F299L	probably benign	Het
Nosip	G	A	7: 45,074,026	A39T	possibly damaging	Het
Nsd1	A	G	13: 55,213,711	D164G	possibly damaging	Het
Ntn1	G	A	11: 68,385,612	T170M	probably damaging	Het
Polrmt	A	T	10: 79,736,562	L1079Q	probably damaging	Het
Rab30	A	G	7: 92,835,797	D129G	possibly damaging	Het
Rwdd2b	C	T	16: 87,436,921	S97N	probably benign	Het
Slitrk3	T	G	3: 73,049,345	D698A	possibly damaging	Het
Smarcd2	T	C	11: 106,267,164	M93V	probably benign	Het
Tmprss4	A	G	9: 45,185,832	V45A	probably benign	Het
Vmn1r22	A	T	6: 57,900,989	M1K	probably null	Het
Vps13a	A	G	19: 16,652,679		probably benign	Het

Other mutations in Cep63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01598:Cep63	APN	9	102590458	missense	possibly damaging	0.88
IGL02378:Cep63	APN	9	102596115	splice site	probably benign
IGL02707:Cep63	APN	9	102586981	missense	probably damaging	1.00
IGL03273:Cep63	APN	9	102602467	missense	probably benign	0.13
R0355:Cep63	UTSW	9	102623560	missense	probably benign
R0847:Cep63	UTSW	9	102588758	missense	probably benign	0.12
R1276:Cep63	UTSW	9	102588900	missense	possibly damaging	0.77
R1398:Cep63	UTSW	9	102603086	splice site	probably benign
R1654:Cep63	UTSW	9	102586913	missense	possibly damaging	0.87
R1730:Cep63	UTSW	9	102618867	missense	possibly damaging	0.93
R1982:Cep63	UTSW	9	102602880	missense	probably damaging	0.99
R2890:Cep63	UTSW	9	102618827	missense	probably damaging	0.99
R3082:Cep63	UTSW	9	102602497	missense	probably benign	0.00
R4725:Cep63	UTSW	9	102590556	intron	probably benign
R4761:Cep63	UTSW	9	102587041	intron	probably benign
R5200:Cep63	UTSW	9	102598188	missense	probably benign	0.22
R5538:Cep63	UTSW	9	102588793	nonsense	probably null
R6463:Cep63	UTSW	9	102596155	missense	probably benign
R6887:Cep63	UTSW	9	102625927	intron	probably benign
R7854:Cep63	UTSW	9	102602998	missense	probably damaging	1.00
R8206:Cep63	UTSW	9	102621271	intron	probably benign
R8465:Cep63	UTSW	9	102613377	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- ACCTGGACCTCATTTGTGAC -3'
(R):5'- CACACTTGTGCTCTCATGTG -3'

Sequencing Primer
(F):5'- GTGACTGTATCTCCTAAGGGAC -3'
(R):5'- GTGCTCTCATGTGTATGCAAC -3'

Posted On

2014-10-30