Incidental Mutation 'R2359:Ntn1'
ID247077
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Namenetrin 1
SynonymsNetrin-1
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R2359 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68209364-68400823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68385612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 170 (T170M)
Ref Sequence ENSEMBL: ENSMUSP00000104314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
Predicted Effect probably damaging
Transcript: ENSMUST00000021284
AA Change: T170M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: T170M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108674
AA Change: T170M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: T170M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135141
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.6558 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Anxa9 A C 3: 95,302,751 L99R probably damaging Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Arid2 G T 15: 96,361,878 L306F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Csf2rb2 C T 15: 78,292,776 V165I probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Efr3b G A 12: 3,980,136 probably benign Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Neurl1b T C 17: 26,441,595 F299L probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Polrmt A T 10: 79,736,562 L1079Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Smarcd2 T C 11: 106,267,164 M93V probably benign Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTAATAGGAGTCGCGCGC -3'
(R):5'- TTCGGATCCCAAGAAAGCGC -3'

Sequencing Primer
(F):5'- TGAAAGCCACGCGGATGTC -3'
(R):5'- TTCCTCACCGACCTCAATAAC -3'
Posted On2014-10-30