Incidental Mutation 'R2359:Csf2rb2'
ID247090
Institutional Source Beutler Lab
Gene Symbol Csf2rb2
Ensembl Gene ENSMUSG00000071714
Gene Namecolony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
SynonymsBil3, AIC2A, Il3r, Il3rb2, BetaIl3
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2359 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78282507-78305721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78292776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 165 (V165I)
Ref Sequence ENSEMBL: ENSMUSP00000094083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096356] [ENSMUST00000230115]
PDB Structure
Extracellular domains of mouse IL-3 beta receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000096356
AA Change: V165I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094083
Gene: ENSMUSG00000071714
AA Change: V165I

DomainStartEndE-ValueType
SCOP:d1gh7a1 29 131 1e-57 SMART
FN3 137 225 3.73e-1 SMART
Pfam:IL6Ra-bind 248 342 6.3e-11 PFAM
FN3 343 425 2.83e0 SMART
transmembrane domain 445 467 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230115
Predicted Effect probably benign
Transcript: ENSMUST00000230753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230932
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Anxa9 A C 3: 95,302,751 L99R probably damaging Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Arid2 G T 15: 96,361,878 L306F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Efr3b G A 12: 3,980,136 probably benign Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Neurl1b T C 17: 26,441,595 F299L probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ntn1 G A 11: 68,385,612 T170M probably damaging Het
Polrmt A T 10: 79,736,562 L1079Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Smarcd2 T C 11: 106,267,164 M93V probably benign Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Csf2rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Csf2rb2 APN 15 78284847 missense possibly damaging 0.78
IGL00765:Csf2rb2 APN 15 78292716 missense probably benign 0.17
IGL01383:Csf2rb2 APN 15 78297043 missense possibly damaging 0.90
IGL01975:Csf2rb2 APN 15 78288886 missense probably benign 0.01
IGL02330:Csf2rb2 APN 15 78285128 missense possibly damaging 0.85
IGL02365:Csf2rb2 APN 15 78287060 missense possibly damaging 0.92
IGL02756:Csf2rb2 APN 15 78284849 missense possibly damaging 0.95
R0269:Csf2rb2 UTSW 15 78288865 missense probably benign 0.09
R0462:Csf2rb2 UTSW 15 78285173 missense probably damaging 1.00
R0540:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0607:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0636:Csf2rb2 UTSW 15 78291960 nonsense probably null
R0782:Csf2rb2 UTSW 15 78286751 missense probably damaging 0.98
R1387:Csf2rb2 UTSW 15 78298214 missense probably damaging 0.99
R1799:Csf2rb2 UTSW 15 78297068 missense probably damaging 1.00
R1881:Csf2rb2 UTSW 15 78292535 intron probably null
R2079:Csf2rb2 UTSW 15 78288007 missense probably benign 0.13
R2108:Csf2rb2 UTSW 15 78292544 missense probably damaging 0.99
R4614:Csf2rb2 UTSW 15 78291702 missense probably damaging 1.00
R4806:Csf2rb2 UTSW 15 78285290 missense probably benign 0.11
R4900:Csf2rb2 UTSW 15 78285974 splice site probably null
R5206:Csf2rb2 UTSW 15 78292752 missense probably benign
R5270:Csf2rb2 UTSW 15 78291982 splice site probably null
R5427:Csf2rb2 UTSW 15 78288911 missense probably damaging 1.00
R6633:Csf2rb2 UTSW 15 78288952 missense probably benign 0.00
R7067:Csf2rb2 UTSW 15 78292494 missense probably damaging 1.00
R7102:Csf2rb2 UTSW 15 78297072 missense probably damaging 1.00
R7117:Csf2rb2 UTSW 15 78285185 missense probably damaging 1.00
R7423:Csf2rb2 UTSW 15 78292560 missense possibly damaging 0.65
R7453:Csf2rb2 UTSW 15 78285291 missense probably benign 0.14
R7705:Csf2rb2 UTSW 15 78284574 missense probably benign 0.02
R7788:Csf2rb2 UTSW 15 78292841 missense probably benign 0.12
R7849:Csf2rb2 UTSW 15 78284421 missense probably benign 0.09
R7851:Csf2rb2 UTSW 15 78288937 missense probably benign 0.10
R7932:Csf2rb2 UTSW 15 78284421 missense probably benign 0.09
R7934:Csf2rb2 UTSW 15 78288937 missense probably benign 0.10
R8057:Csf2rb2 UTSW 15 78285006 missense probably damaging 0.99
RF007:Csf2rb2 UTSW 15 78291926 missense probably benign 0.21
RF009:Csf2rb2 UTSW 15 78291927 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTTTGGCTCTAAATTCACCTG -3'
(R):5'- GCATTTTGCAAGTTTCAGGCC -3'

Sequencing Primer
(F):5'- GGCTCTAAATTCACCTGAAAGTTGC -3'
(R):5'- TTCAGGCCTGAAGCTGAATG -3'
Posted On2014-10-30