Mutagenetix > Incidental Mutations

Incidental Mutation 'R2359:Arid2'

247091

Institutional Source

Beutler Lab

Gene Symbol

Arid2

Ensembl Gene

ENSMUSG00000033237

Gene Name

AT rich interactive domain 2 (ARID, RFX-like)

Synonyms

4432409D24Rik, 1700124K17Rik, zipzap/p200

MMRRC Submission

040341-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2359 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96287518-96404992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 96361878 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 306 (L306F)

Ref Sequence

ENSEMBL: ENSMUSP00000093969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096250]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096250
AA Change: L306F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: L306F

Domain	Start	End	E-Value	Type
ARID	10	101	9.67e-36	SMART
BRIGHT	14	106	3.67e-34	SMART
Pfam:RFX_DNA_binding	521	603	1.7e-26	PFAM
internal_repeat_1	767	843	3.29e-6	PROSPERO
low complexity region	902	942	N/A	INTRINSIC
low complexity region	965	986	N/A	INTRINSIC
low complexity region	1012	1054	N/A	INTRINSIC
low complexity region	1118	1131	N/A	INTRINSIC
internal_repeat_1	1132	1215	3.29e-6	PROSPERO
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1590	1614	N/A	INTRINSIC
ZnF_C2H2	1626	1651	4.34e0	SMART
ZnF_C2H2	1659	1684	4.74e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175735

Meta Mutation Damage Score

0.1014

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	A	T	13: 64,312,651	C12S	probably benign	Het
Adam24	A	G	8: 40,680,945	E484G	possibly damaging	Het
Akr1c20	C	T	13: 4,523,277	G13D	probably damaging	Het
Alkbh3	T	C	2: 94,008,113	T38A	probably benign	Het
Anxa9	A	C	3: 95,302,751	L99R	probably damaging	Het
Arfgef2	A	T	2: 166,860,619	Y826F	probably damaging	Het
Ccdc141	C	T	2: 77,170,402	V29M	probably damaging	Het
Cd55b	A	G	1: 130,418,121	S187P	probably damaging	Het
Cep63	A	C	9: 102,594,564	L526V	possibly damaging	Het
Chtf8	G	T	8: 106,885,416		probably null	Het
Clca4b	T	A	3: 144,925,242	S286C	probably damaging	Het
Cpsf1	A	G	15: 76,597,673	V1080A	probably benign	Het
Csf2rb2	C	T	15: 78,292,776	V165I	probably benign	Het
Cyp2c40	A	T	19: 39,777,954	V399E	probably damaging	Het
Dnmt3a	T	C	12: 3,901,599	S659P	probably damaging	Het
Efr3b	G	A	12: 3,980,136		probably benign	Het
Epha8	A	G	4: 136,946,032	I147T	probably damaging	Het
Fbxo48	G	A	11: 16,953,602	W76*	probably null	Het
Ggt6	A	T	11: 72,437,551	L254F	possibly damaging	Het
Gm11639	T	C	11: 104,739,280	S967P	possibly damaging	Het
Gm4204	T	A	1: 135,232,189		noncoding transcript	Het
Golph3l	A	G	3: 95,591,964		probably null	Het
Gtf2h3	A	G	5: 124,590,876	K166R	probably damaging	Het
Hsp90aa1	A	G	12: 110,694,569		probably null	Het
Hyi	A	G	4: 118,360,341	R79G	probably benign	Het
Igbp1b	G	A	6: 138,657,715	P244S	probably damaging	Het
Ipo8	G	A	6: 148,816,477		probably benign	Het
Larp4b	C	A	13: 9,158,163	T391K	probably damaging	Het
Lrba	T	C	3: 86,348,750	V1133A	probably benign	Het
Med13	C	T	11: 86,291,035		probably benign	Het
Ncapd2	A	G	6: 125,179,416		probably benign	Het
Neurl1b	T	C	17: 26,441,595	F299L	probably benign	Het
Nosip	G	A	7: 45,074,026	A39T	possibly damaging	Het
Nsd1	A	G	13: 55,213,711	D164G	possibly damaging	Het
Ntn1	G	A	11: 68,385,612	T170M	probably damaging	Het
Polrmt	A	T	10: 79,736,562	L1079Q	probably damaging	Het
Rab30	A	G	7: 92,835,797	D129G	possibly damaging	Het
Rwdd2b	C	T	16: 87,436,921	S97N	probably benign	Het
Slitrk3	T	G	3: 73,049,345	D698A	possibly damaging	Het
Smarcd2	T	C	11: 106,267,164	M93V	probably benign	Het
Tmprss4	A	G	9: 45,185,832	V45A	probably benign	Het
Vmn1r22	A	T	6: 57,900,989	M1K	probably null	Het
Vps13a	A	G	19: 16,652,679		probably benign	Het

Other mutations in Arid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Arid2	APN	15	96372302	missense	probably benign
IGL00321:Arid2	APN	15	96289089	missense	probably damaging	0.97
IGL00434:Arid2	APN	15	96371300	missense	probably damaging	0.99
IGL00576:Arid2	APN	15	96356758	missense	probably damaging	0.99
IGL00766:Arid2	APN	15	96370405	missense	probably benign	0.09
IGL01563:Arid2	APN	15	96372397	missense	probably damaging	0.99
IGL01697:Arid2	APN	15	96361572	critical splice acceptor site	probably null
IGL01845:Arid2	APN	15	96356797	missense	probably damaging	1.00
IGL02159:Arid2	APN	15	96358912	splice site	probably benign
IGL02341:Arid2	APN	15	96372185	missense	probably benign
IGL02416:Arid2	APN	15	96350055	missense	possibly damaging	0.63
IGL02578:Arid2	APN	15	96372235	missense	probably benign	0.00
IGL02598:Arid2	APN	15	96371536	missense	probably damaging	1.00
IGL02644:Arid2	APN	15	96368708	missense	probably damaging	1.00
IGL02653:Arid2	APN	15	96287702	missense	probably damaging	0.99
IGL03115:Arid2	APN	15	96370273	missense	probably damaging	1.00
IGL03137:Arid2	APN	15	96371318	missense	probably benign	0.44
IGL03220:Arid2	APN	15	96361772	missense	probably damaging	0.99
IGL03249:Arid2	APN	15	96401965	missense	probably damaging	1.00
IGL03256:Arid2	APN	15	96370762	missense	probably benign	0.18
IGL03386:Arid2	APN	15	96361574	missense	probably damaging	1.00
H8562:Arid2	UTSW	15	96369546	missense	possibly damaging	0.77
I2288:Arid2	UTSW	15	96369511	missense	possibly damaging	0.95
R0254:Arid2	UTSW	15	96370571	missense	probably damaging	0.97
R0284:Arid2	UTSW	15	96378967	splice site	probably benign
R0347:Arid2	UTSW	15	96370952	missense	probably benign	0.01
R0366:Arid2	UTSW	15	96361720	splice site	probably benign
R0400:Arid2	UTSW	15	96356925	unclassified	probably benign
R0650:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R0651:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R1034:Arid2	UTSW	15	96369505	missense	probably benign	0.01
R1615:Arid2	UTSW	15	96371654	missense	possibly damaging	0.59
R1696:Arid2	UTSW	15	96370183	missense	probably benign	0.01
R2024:Arid2	UTSW	15	96361799	missense	probably damaging	1.00
R2046:Arid2	UTSW	15	96369387	missense	probably damaging	1.00
R2069:Arid2	UTSW	15	96362590	missense	probably damaging	1.00
R2149:Arid2	UTSW	15	96370835	missense	probably damaging	1.00
R2300:Arid2	UTSW	15	96402006	missense	probably damaging	1.00
R2336:Arid2	UTSW	15	96362549	missense	probably damaging	1.00
R2368:Arid2	UTSW	15	96350012	missense	possibly damaging	0.83
R2829:Arid2	UTSW	15	96369454	missense	possibly damaging	0.95
R3013:Arid2	UTSW	15	96361936	missense	probably damaging	1.00
R3109:Arid2	UTSW	15	96356746	missense	probably damaging	1.00
R3765:Arid2	UTSW	15	96370714	missense	probably benign	0.01
R3785:Arid2	UTSW	15	96372558	missense	possibly damaging	0.83
R3811:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3812:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3813:Arid2	UTSW	15	96369950	missense	probably benign	0.26
R3843:Arid2	UTSW	15	96351840	missense	possibly damaging	0.86
R3978:Arid2	UTSW	15	96363622	missense	probably damaging	1.00
R4279:Arid2	UTSW	15	96371756	missense	probably damaging	1.00
R4569:Arid2	UTSW	15	96392462	missense	probably damaging	1.00
R4597:Arid2	UTSW	15	96370856	missense	probably damaging	1.00
R5020:Arid2	UTSW	15	96371988	missense	probably damaging	0.96
R5154:Arid2	UTSW	15	96401985	missense	probably damaging	1.00
R5303:Arid2	UTSW	15	96392468	missense	probably damaging	1.00
R5620:Arid2	UTSW	15	96372506	missense	probably benign	0.20
R5766:Arid2	UTSW	15	96372205	missense	probably benign	0.01
R6005:Arid2	UTSW	15	96370972	missense	probably benign
R6169:Arid2	UTSW	15	96368677	missense	probably benign	0.36
R6216:Arid2	UTSW	15	96356909	missense	probably benign	0.18
R6392:Arid2	UTSW	15	96361602	missense	probably damaging	0.99
R6430:Arid2	UTSW	15	96363694	missense	probably benign
R6454:Arid2	UTSW	15	96372413	missense	probably benign	0.20
R6672:Arid2	UTSW	15	96362345	missense	probably benign	0.30
R6776:Arid2	UTSW	15	96370949	missense	probably benign	0.00
R6985:Arid2	UTSW	15	96370148	missense	probably benign	0.06
R7132:Arid2	UTSW	15	96350013	missense	possibly damaging	0.67
R7133:Arid2	UTSW	15	96378875	missense	probably damaging	0.99
R7453:Arid2	UTSW	15	96370724	missense	probably benign
R7562:Arid2	UTSW	15	96401968	missense	probably damaging	1.00
R7594:Arid2	UTSW	15	96390994	missense	probably damaging	1.00
R7692:Arid2	UTSW	15	96356697	nonsense	probably null
R7792:Arid2	UTSW	15	96369375	missense	probably benign	0.05
R8036:Arid2	UTSW	15	96368744	missense	not run
X0024:Arid2	UTSW	15	96372490	missense	probably benign	0.00
X0066:Arid2	UTSW	15	96356804	missense	probably damaging	1.00
Z1177:Arid2	UTSW	15	96390986	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTGACAGAAACAAGGCTCATGG -3'
(R):5'- TGGGATCAGTTACCACCGAAC -3'

Sequencing Primer
(F):5'- GCTCATGGTAAGTCAGTGAAAGTC -3'
(R):5'- GGATCAGTTACCACCGAACTTCAAG -3'

Posted On

2014-10-30