Incidental Mutation 'R2359:Arid2'
ID247091
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2359 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96361878 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 306 (L306F)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
Predicted Effect probably damaging
Transcript: ENSMUST00000096250
AA Change: L306F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: L306F

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175735
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Anxa9 A C 3: 95,302,751 L99R probably damaging Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Csf2rb2 C T 15: 78,292,776 V165I probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Efr3b G A 12: 3,980,136 probably benign Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Neurl1b T C 17: 26,441,595 F299L probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ntn1 G A 11: 68,385,612 T170M probably damaging Het
Polrmt A T 10: 79,736,562 L1079Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Smarcd2 T C 11: 106,267,164 M93V probably benign Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0400:Arid2 UTSW 15 96356925 unclassified probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3785:Arid2 UTSW 15 96372558 missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5620:Arid2 UTSW 15 96372506 missense probably benign 0.20
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6005:Arid2 UTSW 15 96370972 missense probably benign
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6776:Arid2 UTSW 15 96370949 missense probably benign 0.00
R6985:Arid2 UTSW 15 96370148 missense probably benign 0.06
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
R7453:Arid2 UTSW 15 96370724 missense probably benign
R7562:Arid2 UTSW 15 96401968 missense probably damaging 1.00
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACAGAAACAAGGCTCATGG -3'
(R):5'- TGGGATCAGTTACCACCGAAC -3'

Sequencing Primer
(F):5'- GCTCATGGTAAGTCAGTGAAAGTC -3'
(R):5'- GGATCAGTTACCACCGAACTTCAAG -3'
Posted On2014-10-30