Incidental Mutation 'R2359:Neurl1b'
ID247094
Institutional Source Beutler Lab
Gene Symbol Neurl1b
Ensembl Gene ENSMUSG00000034413
Gene Nameneuralized E3 ubiquitin protein ligase 1B
SynonymsC230078M08Rik, Neur2, EG240055
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2359 (G1)
Quality Score215
Status Validated
Chromosome17
Chromosomal Location26414829-26446349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26441595 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 299 (F299L)
Ref Sequence ENSEMBL: ENSMUSP00000138417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053020] [ENSMUST00000182897] [ENSMUST00000183077]
Predicted Effect probably benign
Transcript: ENSMUST00000053020
AA Change: F481L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000051481
Gene: ENSMUSG00000034413
AA Change: F481L

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 192 1e-12 BLAST
Blast:NEUZ 219 245 1e-8 BLAST
NEUZ 268 390 7.66e-24 SMART
low complexity region 436 449 N/A INTRINSIC
low complexity region 457 486 N/A INTRINSIC
RING 494 533 2.38e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182897
AA Change: F299L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138417
Gene: ENSMUSG00000034413
AA Change: F299L

DomainStartEndE-ValueType
Blast:NEUZ 37 63 5e-9 BLAST
Pfam:Neuralized 88 156 2.8e-14 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 304 N/A INTRINSIC
RING 312 351 2.38e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183077
AA Change: F250L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138178
Gene: ENSMUSG00000034413
AA Change: F250L

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 225 2e-14 BLAST
low complexity region 226 255 N/A INTRINSIC
RING 263 302 2.38e-2 SMART
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Anxa9 A C 3: 95,302,751 L99R probably damaging Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Arid2 G T 15: 96,361,878 L306F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Csf2rb2 C T 15: 78,292,776 V165I probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Efr3b G A 12: 3,980,136 probably benign Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ntn1 G A 11: 68,385,612 T170M probably damaging Het
Polrmt A T 10: 79,736,562 L1079Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Smarcd2 T C 11: 106,267,164 M93V probably benign Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Neurl1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Neurl1b APN 17 26432178 missense probably damaging 0.99
R0530:Neurl1b UTSW 17 26441545 splice site probably null
R1819:Neurl1b UTSW 17 26438700 missense probably benign 0.01
R3720:Neurl1b UTSW 17 26414975 missense probably damaging 1.00
R4574:Neurl1b UTSW 17 26431886 missense probably benign 0.19
R7508:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7509:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7642:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7654:Neurl1b UTSW 17 26438697 missense probably benign 0.00
R7669:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7670:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7722:Neurl1b UTSW 17 26441158 missense probably benign
R8069:Neurl1b UTSW 17 26432227 missense not run
Predicted Primers PCR Primer
(F):5'- CCTTTGTGCTTTGTGAGACAGC -3'
(R):5'- ACAGCTACGGCCTGTAGATC -3'

Sequencing Primer
(F):5'- TGCTTTGTGAGACAGCACTATC -3'
(R):5'- ATAACATCCTTGATGGGCCG -3'
Posted On2014-10-30